Regulon of YtrA in Clostridium butyricum 5521

Properties
Regulator type:	Transcription factor
TF locus tag:	CBY_1392
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux; Antibiotic resistance
Effector:
Regulog:	YtrA - Clostridia-1
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-1
By TF family - GntR/Others
By pathway - Multidrug resistance
By pathway - Multidrug efflux
By pathway - Antibiotic resistance

Regulated operons
	Locus Tag	Name	Function
Position: -48 Score: 6.7 Sequence: AGGTGTACTAGTTCAAATAGTACACCT Locus tag: CBY_1391 Name: Cbei_1884 Funciton: hypothetical protein Locus tag: CBY_1392 Name: ytrA Funciton: Transcriptional regulator, GntR family Locus tag: CBY_1393 Name: ytrB Funciton: ABC-type transport system, ATPase component Locus tag: CBY_1394 Name: ytrC Funciton: ABC-type transport system, permease component
	CBY_1391	Cbei_1884	hypothetical protein
	CBY_1392	ytrA	Transcriptional regulator, GntR family
	CBY_1393	ytrB	ABC-type transport system, ATPase component
	CBY_1394	ytrC	ABC-type transport system, permease component

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD