Regulon of YtrA in Clostridium botulinum A str. ATCC 3502
| Regulator type: | Transcription factor |
| TF locus tag: | CBO2790 |
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | Multidrug resistance; Multidrug efflux; Antibiotic resistance |
| Effector: | |
| Regulog: | YtrA - Clostridia-1 |
| Statistics of regulated genes: | |
| - Genes | 4 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Clostridia-1
- By TF family - GntR/Others
- By pathway - Multidrug resistance
- By pathway - Multidrug efflux
- By pathway - Antibiotic resistance
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -84
Score: 6.9 Sequence: AAGTGTATTAGGTGTAGTAGTACACTT
Locus tag: CBO2791
Name: null Funciton: Teicoplanin resistance protein
Locus tag: CBO2790
Name: ytrA Funciton: Transcriptional regulator, GntR family
Locus tag: CBO2789
Name: ytrB Funciton: ABC-type transport system, ATPase component
Locus tag: CBO2788
Name: ytrC Funciton: ABC-type transport system, permease component |
|||
|
Teicoplanin resistance protein
|
|||
|
ytrA
|
Transcriptional regulator, GntR family
|
||
|
ytrB
|
ABC-type transport system, ATPase component
|
||
|
ytrC
|
ABC-type transport system, permease component
|
||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |