Regulon of YtrA in Clostridium beijerincki NCIMB 8052

Properties
Regulator type:	Transcription factor
TF locus tag:	Cbei_1885
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux; Antibiotic resistance
Effector:
Regulog:	YtrA - Clostridia-1
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-1
By TF family - GntR/Others
By pathway - Multidrug resistance
By pathway - Multidrug efflux
By pathway - Antibiotic resistance

Regulated operons
	Locus Tag	Name	Function
Position: 74 Score: 6.9 Sequence: AAGTGTACTATATGAGCTAGTACACTT Locus tag: Cbei_1884 Name: Cbei_1884 Funciton: hypothetical protein Locus tag: Cbei_1885 Name: ytrA Funciton: Transcriptional regulator, GntR family Locus tag: Cbei_1886 Name: ytrB Funciton: ABC-type transport system, ATPase component Locus tag: Cbei_1887 Name: ytrC Funciton: ABC-type transport system, permease component
	Cbei_1884	Cbei_1884	hypothetical protein
	Cbei_1885	ytrA	Transcriptional regulator, GntR family
	Cbei_1886	ytrB	ABC-type transport system, ATPase component
	Cbei_1887	ytrC	ABC-type transport system, permease component

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD