Regulon of LndYR in Actinosynnema mirum DSM 43827

Properties
Regulator type:	Transcription factor
TF locus tag:	Amir_6371
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Antibiotic resistance
Effector:
Regulog:	LndYR - Frankineae/Propionibacterineae/Pseudonocardiaceae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Frankineae/Propionibacterineae/Pseudonocardiaceae
By TF family - GntR/Others
By pathway - Antibiotic resistance

Regulated operons
	Locus Tag	Name	Function
Position: -53 Score: 3.8 Sequence: GGTGTACCTGTTATCTAGTGTCTT Locus tag: Amir_6371 Name: lndYR Funciton: Transcriptional regulator of landomycin production, GntR family Locus tag: Amir_6370 Name: lndWA Funciton: Landomycin ABC transporter, ATP-binding protein Locus tag: Amir_6369 Name: lndWP Funciton: Landomycin ABC transporter, permease protein
	Amir_6371	lndYR	Transcriptional regulator of landomycin production, GntR family
	Amir_6370	lndWA	Landomycin ABC transporter, ATP-binding protein
	Amir_6369	lndWP	Landomycin ABC transporter, permease protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD