Statistics of regulated genes

Genome	Genes	Operons
Actinosynnema mirum DSM 43827	3	1
Saccharomonospora viridis DSM 43017	3	1
Saccharopolyspora erythraea NRRL 2338	3	1
Acidothermus cellulolyticus 11B
Frankia sp. CcI3
Frankia sp. EAN1pec	3	1
Nakamurella multipartita DSM 44233	4	2
Nocardioides sp. JS614
Propionibacterium acnes KPA171202

Clusters of co-Regulated Orthologous operoNs (CRONs)

Genes										Function
CRON 1.
lndYR	* Actinosynnema mirum DSM 43827 Site: position = -53 score = 3.83996 sequence = GGTGTACCTGTTATCTAGTGTCTT Gene: Amir_6371: Transcriptional regulator of landomycin production, GntR family	* Saccharomonospora viridis DSM 43017 Site: position = -42 score = 4.50651 sequence = GGTTACCTACATGACTAATGAACC Gene: Svir_39240: Transcriptional regulator of landomycin production, GntR family	* Saccharopolyspora erythraea NRRL 2338 Site: position = -44 score = 3.7268 sequence = ATTATCCTATGGTCATAGGTAATT Gene: SACE_7195: Transcriptional regulator of landomycin production, GntR family	Acidothermus cellulolyticus 11B	Frankia sp. CcI3	* Frankia sp. EAN1pec Site: position = -204 score = 3.52427 sequence = GAACCATCAGCGACCTAATGAACA Gene: Franean1_1345: Transcriptional regulator of landomycin production, GntR family	*2 Nakamurella multipartita DSM 44233 Site: position = -28 score = 5.99896 sequence = ATTGCACTAGTTGAGTAGTGTAAT Gene: Namu_2305: Transcriptional regulator of landomycin production, GntR family Site: position = -27 score = 5.38685 sequence = GGTACACTAGTTAACTAGTCTTCT Gene: Namu_3575: Transcriptional regulator of landomycin production, GntR family	Nocardioides sp. JS614	Propionibacterium acnes KPA171202	Transcriptional regulator of landomycin production, GntR family
lndWA	Actinosynnema mirum DSM 43827 Gene: Amir_6370: Landomycin ABC transporter, ATP-binding protein	Saccharomonospora viridis DSM 43017 Gene: Svir_39230: Landomycin ABC transporter, ATP-binding protein	Saccharopolyspora erythraea NRRL 2338 Gene: SACE_7194: Landomycin ABC transporter, ATP-binding protein	Acidothermus cellulolyticus 11B	Frankia sp. CcI3	Frankia sp. EAN1pec Gene: Franean1_1344: Landomycin ABC transporter, ATP-binding protein	2 Nakamurella multipartita DSM 44233 Gene: Namu_2306: Landomycin ABC transporter, ATP-binding protein Gene: Namu_3574: Landomycin ABC transporter, ATP-binding protein	Nocardioides sp. JS614	Propionibacterium acnes KPA171202	Landomycin ABC transporter, ATP-binding protein
lndWP	Actinosynnema mirum DSM 43827 Gene: Amir_6369: Landomycin ABC transporter, permease protein	Saccharomonospora viridis DSM 43017 Gene: Svir_39220: Landomycin ABC transporter, permease protein	Saccharopolyspora erythraea NRRL 2338 Gene: SACE_7193: Landomycin ABC transporter, permease protein	Acidothermus cellulolyticus 11B	Frankia sp. CcI3	Frankia sp. EAN1pec Gene: Franean1_1343: Landomycin ABC transporter, permease protein	Nakamurella multipartita DSM 44233	Nocardioides sp. JS614	Propionibacterium acnes KPA171202	Landomycin ABC transporter, permease protein

Export

	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD