Regulog LndYR - Frankineae/Propionibacterineae/Pseudonocardiaceae
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | Antibiotic resistance |
| Effector: | |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Frankineae/Propionibacterineae/Pseudonocardiaceae
- By TF family - GntR/Others
- By pathway - Antibiotic resistance
| Genome | Genes | Operons |
|---|---|---|
| Actinosynnema mirum DSM 43827 | 3 | 1 |
| Saccharomonospora viridis DSM 43017 | 3 | 1 |
| Saccharopolyspora erythraea NRRL 2338 | 3 | 1 |
| Acidothermus cellulolyticus 11B | ||
| Frankia sp. CcI3 | ||
| Frankia sp. EAN1pec | 3 | 1 |
| Nakamurella multipartita DSM 44233 | 4 | 2 |
| Nocardioides sp. JS614 | ||
| Propionibacterium acnes KPA171202 |
| Genes | Function | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||
| lndYR |
*
Actinosynnema mirum DSM 43827 Site: position = -53 score = 3.83996 sequence = GGTGTACCTGTTATCTAGTGTCTT Gene: Amir_6371: Transcriptional regulator of landomycin production, GntR family |
*
Saccharomonospora viridis DSM 43017 Site: position = -42 score = 4.50651 sequence = GGTTACCTACATGACTAATGAACC Gene: Svir_39240: Transcriptional regulator of landomycin production, GntR family |
*
Saccharopolyspora erythraea NRRL 2338 Site: position = -44 score = 3.7268 sequence = ATTATCCTATGGTCATAGGTAATT Gene: SACE_7195: Transcriptional regulator of landomycin production, GntR family |
|
|
*
Frankia sp. EAN1pec Site: position = -204 score = 3.52427 sequence = GAACCATCAGCGACCTAATGAACA Gene: Franean1_1345: Transcriptional regulator of landomycin production, GntR family |
*2
Nakamurella multipartita DSM 44233 Site: position = -28 score = 5.99896 sequence = ATTGCACTAGTTGAGTAGTGTAAT Gene: Namu_2305: Transcriptional regulator of landomycin production, GntR family Site: position = -27 score = 5.38685 sequence = GGTACACTAGTTAACTAGTCTTCT Gene: Namu_3575: Transcriptional regulator of landomycin production, GntR family |
|
|
Transcriptional regulator of landomycin production, GntR family |
| lndWA |
Gene: Amir_6370: Landomycin ABC transporter, ATP-binding protein |
Gene: Svir_39230: Landomycin ABC transporter, ATP-binding protein |
Gene: SACE_7194: Landomycin ABC transporter, ATP-binding protein |
|
|
Gene: Franean1_1344: Landomycin ABC transporter, ATP-binding protein |
2
Nakamurella multipartita DSM 44233 Gene: Namu_2306: Landomycin ABC transporter, ATP-binding protein Gene: Namu_3574: Landomycin ABC transporter, ATP-binding protein |
|
|
Landomycin ABC transporter, ATP-binding protein |
| lndWP |
Gene: Amir_6369: Landomycin ABC transporter, permease protein |
Gene: Svir_39220: Landomycin ABC transporter, permease protein |
Gene: SACE_7193: Landomycin ABC transporter, permease protein |
|
|
Gene: Franean1_1343: Landomycin ABC transporter, permease protein |
|
|
|
Landomycin ABC transporter, permease protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |