Regulon of Csac_2497 in Caldicellulosiruptor saccharolyticus DSM 8903

Properties
Regulator type:	Transcription factor
TF locus tag:	Csac_2497
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Regulog:	Csac_2497 - Thermoanaerobacterales
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Thermoanaerobacterales
By TF family - GntR/Others
By pathway - Multidrug resistance
By pathway - Multidrug efflux

Regulated operons
	Locus Tag	Name	Function
Position: -54 Score: 7.6 Sequence: AATTAAAACTGTATATACTGTATATATACAGTATGCAAA Position: -45 Score: 6.1 Sequence: TGTATATACTGTATATATACAGTATGCAAAAGGGGAAAG Locus tag: Csac_2497 Name: Csac_2497 Funciton: Transcriptional regulator, GntR family Locus tag: Csac_2498 Name: BH0652 Funciton: ABC-type multidrug transport system, ATPase component Locus tag: Csac_2499 Name: BH0653 Funciton: ABC-type multidrug transport system, permease component
	Csac_2497	Csac_2497	Transcriptional regulator, GntR family
	Csac_2498	BH0652	ABC-type multidrug transport system, ATPase component
	Csac_2499	BH0653	ABC-type multidrug transport system, permease component

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD