Regulon of ABC3918 in Bacillus clausii KSM-K16

Properties
Regulator type:	Transcription factor
TF locus tag:	ABC3918
Regulator family:	GntR/Others
Regulation mode:
Biological process:
Effector:
Regulog:	ABC3918 - Bacillales
Statistics of regulated genes:
- Genes	5
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - GntR/Others

Regulated operons
	Locus Tag	Name	Function
Position: -52 Score: 7.3 Sequence: AATACTGTGTATGTAGATATAAACAGATGA Locus tag: ABC3919 Name: ABC3919 Funciton: hypothetical protein Locus tag: ABC3918 Name: ABC3918 Funciton: Transcriptional regulator, GntR family Locus tag: ABC3917 Name: ABC3917 Funciton: ABC transporter, ATP-binding protein Locus tag: ABC3916 Name: ABC3916 Funciton: ABC transporter, ATP-binding protein Locus tag: ABC3915 Name: ABC3915 Funciton: Putative ABC-type Na+ efflux pump, permease component
	ABC3919	ABC3919	hypothetical protein
	ABC3918	ABC3918	Transcriptional regulator, GntR family
	ABC3917	ABC3917	ABC transporter, ATP-binding protein
	ABC3916	ABC3916	ABC transporter, ATP-binding protein
	ABC3915	ABC3915	Putative ABC-type Na+ efflux pump, permease component

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD