Regulog ABC3918 - Bacillales

Properties
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:
Biological process:
Effector:
Phylum:	Firmicutes
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - GntR/Others

Statistics of regulated genes
Genome	Genes	Operons
Anoxybacillus flavithermus WK1
Bacillus amyloliquefaciens FZB42
Bacillus cereus ATCC 14579
Bacillus clausii KSM-K16	5	1
Bacillus halodurans C-125	5	1
Bacillus licheniformis DSM 13
Bacillus pumilus SAFR-032
Bacillus subtilis subsp. subtilis str. 168
Geobacillus kaustophilus HTA426
Oceanobacillus iheyensis HTE831
Paenibacillus sp. JDR-2	5	1

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes												Function

CRON 1.
ABC3919	Anoxybacillus flavithermus WK1	Bacillus amyloliquefaciens FZB42	Bacillus cereus ATCC 14579	* Bacillus clausii KSM-K16 Site: position = -52 score = 7.25006 sequence = AATACTGTGTATGTAGATATAAACAGATGA Gene: ABC3919: hypothetical protein	* Bacillus halodurans C-125 Site: position = -49 score = 7.25006 sequence = TATACTGTGTATATAGATATTAACACATAA Gene: BH1163: hypothetical protein	Bacillus licheniformis DSM 13	Bacillus pumilus SAFR-032	Bacillus subtilis subsp. subtilis str. 168	Geobacillus kaustophilus HTA426	Oceanobacillus iheyensis HTE831	* Paenibacillus sp. JDR-2 Site: position = -59 score = 7.87036 sequence = TATACTGTGTATAAGGATATACACAGTATA Gene: Pjdr2_5298: hypothetical protein	hypothetical protein
ABC3918	Anoxybacillus flavithermus WK1	Bacillus amyloliquefaciens FZB42	Bacillus cereus ATCC 14579	Bacillus clausii KSM-K16 Gene: ABC3918: Transcriptional regulator, GntR family	Bacillus halodurans C-125 Gene: BH1164: Transcriptional regulator, GntR family	Bacillus licheniformis DSM 13	Bacillus pumilus SAFR-032	Bacillus subtilis subsp. subtilis str. 168	Geobacillus kaustophilus HTA426	Oceanobacillus iheyensis HTE831	Paenibacillus sp. JDR-2 Gene: Pjdr2_5297: Transcriptional regulator, GntR family	Transcriptional regulator, GntR family
ABC3917	Anoxybacillus flavithermus WK1	Bacillus amyloliquefaciens FZB42	Bacillus cereus ATCC 14579	Bacillus clausii KSM-K16 Gene: ABC3917: ABC transporter, ATP-binding protein	Bacillus halodurans C-125 Gene: BH1165: ABC transporter, ATP-binding protein	Bacillus licheniformis DSM 13	Bacillus pumilus SAFR-032	Bacillus subtilis subsp. subtilis str. 168	Geobacillus kaustophilus HTA426	Oceanobacillus iheyensis HTE831	Paenibacillus sp. JDR-2 Gene: Pjdr2_5296: ABC transporter, ATP-binding protein	ABC transporter, ATP-binding protein
ABC3916	Anoxybacillus flavithermus WK1 Gene: Aflv_1274: ABC transporter, ATP-binding protein	Bacillus amyloliquefaciens FZB42 Gene: RBAM_010130: ABC transporter, ATP-binding protein	Bacillus cereus ATCC 14579	Bacillus clausii KSM-K16 Gene: ABC3916: ABC transporter, ATP-binding protein	Bacillus halodurans C-125 Gene: BH1166: ABC transporter, ATP-binding protein	Bacillus licheniformis DSM 13 Gene: BLi01066: ABC transporter, ATP-binding protein	Bacillus pumilus SAFR-032	Bacillus subtilis subsp. subtilis str. 168 Gene: BSU09890: ABC transporter, ATP-binding protein	Geobacillus kaustophilus HTA426 Gene: GK0644: ABC transporter, ATP-binding protein	Oceanobacillus iheyensis HTE831 Gene: OB1138: ABC transporter, ATP-binding protein	Paenibacillus sp. JDR-2 Gene: Pjdr2_5295: ABC transporter, ATP-binding protein	ABC transporter, ATP-binding protein
ABC3915	Anoxybacillus flavithermus WK1 Gene: Aflv_1275: Putative ABC-type Na+ efflux pump, permease component	Bacillus amyloliquefaciens FZB42 Gene: RBAM_010140: Putative ABC-type Na+ efflux pump, permease component	Bacillus cereus ATCC 14579	Bacillus clausii KSM-K16 Gene: ABC3915: Putative ABC-type Na+ efflux pump, permease component	Bacillus halodurans C-125 Gene: BH1167: Putative ABC-type Na+ efflux pump, permease component	Bacillus licheniformis DSM 13 Gene: BLi01067: Putative ABC-type Na+ efflux pump, permease component	Bacillus pumilus SAFR-032	Bacillus subtilis subsp. subtilis str. 168 Gene: BSU09900: Putative ABC-type Na+ efflux pump, permease component	Geobacillus kaustophilus HTA426 Gene: GK0645: Putative ABC-type Na+ efflux pump, permease component	Oceanobacillus iheyensis HTE831 Gene: OB1139: Putative ABC-type Na+ efflux pump, permease component	Paenibacillus sp. JDR-2 Gene: Pjdr2_5294: Putative ABC-type Na+ efflux pump, permease component	Putative ABC-type Na+ efflux pump, permease component

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog ABC3918 - Bacillales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --