Regulog ABC3918 - Bacillales
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | |
| Effector: | |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bacillales
- By TF family - GntR/Others
| Genome | Genes | Operons |
|---|---|---|
| Anoxybacillus flavithermus WK1 | ||
| Bacillus amyloliquefaciens FZB42 | ||
| Bacillus cereus ATCC 14579 | ||
| Bacillus clausii KSM-K16 | 5 | 1 |
| Bacillus halodurans C-125 | 5 | 1 |
| Bacillus licheniformis DSM 13 | ||
| Bacillus pumilus SAFR-032 | ||
| Bacillus subtilis subsp. subtilis str. 168 | ||
| Geobacillus kaustophilus HTA426 | ||
| Oceanobacillus iheyensis HTE831 | ||
| Paenibacillus sp. JDR-2 | 5 | 1 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| ABC3919 |
|
|
|
*
Bacillus clausii KSM-K16 Site: position = -52 score = 7.25006 sequence = AATACTGTGTATGTAGATATAAACAGATGA Gene: ABC3919: hypothetical protein |
*
Bacillus halodurans C-125 Site: position = -49 score = 7.25006 sequence = TATACTGTGTATATAGATATTAACACATAA Gene: BH1163: hypothetical protein |
|
|
|
|
|
*
Paenibacillus sp. JDR-2 Site: position = -59 score = 7.87036 sequence = TATACTGTGTATAAGGATATACACAGTATA Gene: Pjdr2_5298: hypothetical protein |
hypothetical protein |
| ABC3918 |
|
|
|
Gene: ABC3918: Transcriptional regulator, GntR family |
Gene: BH1164: Transcriptional regulator, GntR family |
|
|
|
|
|
Gene: Pjdr2_5297: Transcriptional regulator, GntR family |
Transcriptional regulator, GntR family |
| ABC3917 |
|
|
|
Gene: ABC3917: ABC transporter, ATP-binding protein |
Gene: BH1165: ABC transporter, ATP-binding protein |
|
|
|
|
|
Gene: Pjdr2_5296: ABC transporter, ATP-binding protein |
ABC transporter, ATP-binding protein |
| ABC3916 |
Gene: Aflv_1274: ABC transporter, ATP-binding protein |
Gene: RBAM_010130: ABC transporter, ATP-binding protein |
|
Gene: ABC3916: ABC transporter, ATP-binding protein |
Gene: BH1166: ABC transporter, ATP-binding protein |
Gene: BLi01066: ABC transporter, ATP-binding protein |
|
Gene: BSU09890: ABC transporter, ATP-binding protein |
Gene: GK0644: ABC transporter, ATP-binding protein |
Gene: OB1138: ABC transporter, ATP-binding protein |
Gene: Pjdr2_5295: ABC transporter, ATP-binding protein |
ABC transporter, ATP-binding protein |
| ABC3915 |
Gene: Aflv_1275: Putative ABC-type Na+ efflux pump, permease component |
Gene: RBAM_010140: Putative ABC-type Na+ efflux pump, permease component |
|
Gene: ABC3915: Putative ABC-type Na+ efflux pump, permease component |
Gene: BH1167: Putative ABC-type Na+ efflux pump, permease component |
Gene: BLi01067: Putative ABC-type Na+ efflux pump, permease component |
|
Gene: BSU09900: Putative ABC-type Na+ efflux pump, permease component |
Gene: GK0645: Putative ABC-type Na+ efflux pump, permease component |
Gene: OB1139: Putative ABC-type Na+ efflux pump, permease component |
Gene: Pjdr2_5294: Putative ABC-type Na+ efflux pump, permease component |
Putative ABC-type Na+ efflux pump, permease component |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |