Regulon of Mce2R in Nocardioides sp. JS614

Properties
Regulator type:	Transcription factor
TF locus tag:	Noca_0011
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Fatty acid metabolism
Effector:
Regulog:	Mce2R - Frankineae/Propionibacterineae/Pseudonocardiaceae
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 1 sites [see more]

Member of regulog collections

By taxonomy - Frankineae/Propionibacterineae/Pseudonocardiaceae
By TF family - GntR/Others
By pathway - Fatty acid metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -36 Score: 5.5 Sequence: CAATCTGGTCTGACCACTTGA Locus tag: Noca_0011 Name: mce2R Funciton: Transcriptional regulator, GntR family Locus tag: Noca_0010 Name: fah Funciton: Fatty acid hydroxylase FAH1P
	Noca_0011	mce2R	Transcriptional regulator, GntR family
	Noca_0010	fah	Fatty acid hydroxylase FAH1P

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD