Regulon of SACE_6121 in Frankia sp. EAN1pec

Properties
Regulator type:	Transcription factor
TF locus tag:	Franean1_4641
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug efflux
Effector:
Regulog:	SACE_6121 - Frankineae/Propionibacterineae/Pseudonocardiaceae
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

By taxonomy - Frankineae/Propionibacterineae/Pseudonocardiaceae
By TF family - GntR/Others
By pathway - Multidrug efflux

Regulated operons
	Locus Tag	Name	Function
Position: -22 Score: 5.3 Sequence: TGGTGCTAATAATACTAGCACTA Locus tag: Franean1_4641 Name: SACE_6121 Funciton: Transcriptional regulator, GntR family Locus tag: Franean1_4640 Name: SCO3813 Funciton: putative membrane protein
	Franean1_4641	SACE_6121	Transcriptional regulator, GntR family
	Franean1_4640	SCO3813	putative membrane protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD