Regulog SACE_6121 - Frankineae/Propionibacterineae/Pseudonocardiaceae

Properties
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug efflux
Effector:
Phylum:	Actinobacteria
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

Statistics of regulated genes
Genome	Genes	Operons
Actinosynnema mirum DSM 43827
Saccharomonospora viridis DSM 43017	2	1
Saccharopolyspora erythraea NRRL 2338	2	1
Acidothermus cellulolyticus 11B
Frankia sp. CcI3
Frankia sp. EAN1pec	2	1
Nakamurella multipartita DSM 44233
Nocardioides sp. JS614
Propionibacterium acnes KPA171202

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes										Function

CRON 1.
SACE_6121	Actinosynnema mirum DSM 43827	* Saccharomonospora viridis DSM 43017 Site: position = -22 score = 5.91544 sequence = TTGTTCTAGTAGAATTAGAACAA Gene: Svir_03590: Transcriptional regulator, GntR family	* Saccharopolyspora erythraea NRRL 2338 Site: position = -34 score = 5.46377 sequence = TGGTGCTAATGTCGATAGCACCA Gene: SACE_6121: Transcriptional regulator, GntR family	Acidothermus cellulolyticus 11B	Frankia sp. CcI3	* Frankia sp. EAN1pec Site: position = -22 score = 5.30257 sequence = TGGTGCTAATAATACTAGCACTA Gene: Franean1_4641: Transcriptional regulator, GntR family	Nakamurella multipartita DSM 44233	Nocardioides sp. JS614	Propionibacterium acnes KPA171202	Transcriptional regulator, GntR family
SCO3813	Actinosynnema mirum DSM 43827	Saccharomonospora viridis DSM 43017 Gene: Svir_03580: putative membrane protein	Saccharopolyspora erythraea NRRL 2338 Gene: SACE_6120: putative membrane protein	Acidothermus cellulolyticus 11B	Frankia sp. CcI3	Frankia sp. EAN1pec Gene: Franean1_4640: putative membrane protein	Nakamurella multipartita DSM 44233	Nocardioides sp. JS614	Propionibacterium acnes KPA171202	putative membrane protein

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --