Regulon of ECA4246 in Erwinia carotovora subsp. atroseptica SCRI1043
| Regulator type: | Transcription factor |
| TF locus tag: | ECA4246 |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Regulog: | ECA4246 - Enterobacteriales |
| Statistics of regulated genes: | |
| - Genes | 5 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Enterobacteriales
- By TF family - LacI
- By pathway - Sugar utilization
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -12
Score: 6.8 Sequence: GAATGCACAGCTGTGCAAAA
Locus tag: ECA4250
Name: ECA4250 Funciton: Predicted sugar ABC transporter, ATP-binding protein
Locus tag: ECA4249
Name: ECA4249 Funciton: Predicted sugar ABC transporter, substrate-binding protein
Locus tag: ECA4248
Name: ECA4248 Funciton: Predicted sugar ABC transporter, permease protein 1
Locus tag: ECA4247
Name: ECA4247 Funciton: Predicted sugar ABC transporter, permease protein 2
Locus tag: ECA4246
Name: ECA4246 Funciton: Predicted transcriptional regulator, LacI family |
|||
|
ECA4250
|
Predicted sugar ABC transporter, ATP-binding protein
|
||
|
ECA4249
|
Predicted sugar ABC transporter, substrate-binding protein
|
||
|
ECA4248
|
Predicted sugar ABC transporter, permease protein 1
|
||
|
ECA4247
|
Predicted sugar ABC transporter, permease protein 2
|
||
|
ECA4246
|
Predicted transcriptional regulator, LacI family
|
||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |