Regulon of ECA4246 in Erwinia carotovora subsp. atroseptica SCRI1043

Properties
Regulator type:	Transcription factor
TF locus tag:	ECA4246
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	ECA4246 - Enterobacteriales
Statistics of regulated genes:
- Genes	5
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 1 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -12 Score: 6.8 Sequence: GAATGCACAGCTGTGCAAAA Locus tag: ECA4250 Name: ECA4250 Funciton: Predicted sugar ABC transporter, ATP-binding protein Locus tag: ECA4249 Name: ECA4249 Funciton: Predicted sugar ABC transporter, substrate-binding protein Locus tag: ECA4248 Name: ECA4248 Funciton: Predicted sugar ABC transporter, permease protein 1 Locus tag: ECA4247 Name: ECA4247 Funciton: Predicted sugar ABC transporter, permease protein 2 Locus tag: ECA4246 Name: ECA4246 Funciton: Predicted transcriptional regulator, LacI family
	ECA4250	ECA4250	Predicted sugar ABC transporter, ATP-binding protein
	ECA4249	ECA4249	Predicted sugar ABC transporter, substrate-binding protein
	ECA4248	ECA4248	Predicted sugar ABC transporter, permease protein 1
	ECA4247	ECA4247	Predicted sugar ABC transporter, permease protein 2
	ECA4246	ECA4246	Predicted transcriptional regulator, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD