Regulog ECA4246 - Enterobacteriales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Enterobacteriales
- By TF family - LacI
- By pathway - Sugar utilization
| Genome | Genes | Operons |
|---|---|---|
| Citrobacter koseri ATCC BAA-895 | ||
| Edwardsiella tarda EIB202 | ||
| Enterobacter sp. 638 | ||
| Erwinia amylovora ATCC 49946 | ||
| Erwinia carotovora subsp. atroseptica SCRI1043 | 5 | 1 |
| Escherichia coli str. K-12 substr. MG1655 | ||
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | ||
| Photorhabdus luminescens subsp. laumondii TTO1 | ||
| Proteus mirabilis HI4320 | ||
| Salmonella typhimurium LT2 | ||
| Serratia proteamaculans 568 | ||
| Yersinia pestis KIM |
| Genes | Function | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||
| ECA4250 |
|
|
|
|
*
Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -12 score = 6.84977 sequence = GAATGCACAGCTGTGCAAAA Gene: ECA4250: Predicted sugar ABC transporter, ATP-binding protein |
|
Gene: KPN_04456: Predicted sugar ABC transporter, ATP-binding protein |
|
|
|
|
|
Predicted sugar ABC transporter, ATP-binding protein |
| ECA4249 |
|
|
|
|
Gene: ECA4249: Predicted sugar ABC transporter, substrate-binding protein |
|
Gene: KPN_04457: Predicted sugar ABC transporter, substrate-binding protein |
|
|
|
|
|
Predicted sugar ABC transporter, substrate-binding protein |
| ECA4248 |
|
|
|
|
Gene: ECA4248: Predicted sugar ABC transporter, permease protein 1 |
|
Gene: KPN_04458: Predicted sugar ABC transporter, permease protein 1 |
|
|
|
|
|
Predicted sugar ABC transporter, permease protein 1 |
| ECA4247 |
|
|
|
|
Gene: ECA4247: Predicted sugar ABC transporter, permease protein 2 |
|
Gene: KPN_04459: Predicted sugar ABC transporter, permease protein 2 |
|
|
|
|
Gene: y2280: Predicted sugar ABC transporter, permease protein 2 |
Predicted sugar ABC transporter, permease protein 2 |
| ECA4246 |
|
|
|
|
Gene: ECA4246: Predicted transcriptional regulator, LacI family |
|
|
|
|
|
|
|
Predicted transcriptional regulator, LacI family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |