Regulon of XltR in Marinomonas sp. MWYL1

Properties
Regulator type:	Transcription factor
TF locus tag:	Mmwyl1_1984
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Xylitol utilization
Effector:	Xylitol
Regulog:	XltR - Oceanospirillales/Alteromonadales
Statistics of regulated genes:
- Genes	7
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 11 sites [see more]

Member of regulog collections

By taxonomy - Oceanospirillales/Alteromonadales
By TF family - LacI
By effector - Xylitol
By pathway - Xylitol utilization

Regulated operons
	Locus Tag	Name	Function
Position: -187 Score: 6.3 Sequence: TAATGTTAACGTTAACATTC Position: -181 Score: 4.8 Sequence: TAACGTTAACATTCACATTC Position: -131 Score: 5.7 Sequence: AAATGTTAACGATAACATCA Locus tag: Mmwyl1_1984 Name: xltR Funciton: Transcriptional regulator of xylitol utilization, LacI family
	Mmwyl1_1984	xltR	Transcriptional regulator of xylitol utilization, LacI family
Position: -124 Score: 5.7 Sequence: TGATGTTATCGTTAACATTT Position: -74 Score: 4.8 Sequence: GAATGTGAATGTTAACGTTA Position: -68 Score: 6.3 Sequence: GAATGTTAACGTTAACATTA Locus tag: Mmwyl1_1985 Name: xltC Funciton: Xylitol ABC transporter, periplasmic substrate-binding protein Locus tag: Mmwyl1_1986 Name: xltA Funciton: Xylitol ABC transporter, ATP-binding component Locus tag: Mmwyl1_1987 Name: xltB Funciton: Xylitol ABC transporter, permease component Locus tag: Mmwyl1_1988 Name: xylB Funciton: Xylulose kinase (EC 2.7.1.17) Locus tag: Mmwyl1_1989 Name: xylB Funciton: Xylulose kinase (EC 2.7.1.17) Locus tag: Mmwyl1_1990 Name: dhs Funciton: Diacetyl/L-xylulose reductase (EC 1.1.1.10)
	Mmwyl1_1985	xltC	Xylitol ABC transporter, periplasmic substrate-binding protein
	Mmwyl1_1986	xltA	Xylitol ABC transporter, ATP-binding component
	Mmwyl1_1987	xltB	Xylitol ABC transporter, permease component
	Mmwyl1_1988	xylB	Xylulose kinase (EC 2.7.1.17)
	Mmwyl1_1989	xylB	Xylulose kinase (EC 2.7.1.17)
	Mmwyl1_1990	dhs	Diacetyl/L-xylulose reductase (EC 1.1.1.10)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD