Regulog XltR - Oceanospirillales/Alteromonadales

Properties
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Xylitol utilization
Effector:	Xylitol
Phylum:	Proteobacteria/gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 11 sites [see more]

Member of regulog collections

By taxonomy - Oceanospirillales/Alteromonadales
By TF family - LacI
By effector - Xylitol
By pathway - Xylitol utilization

Statistics of regulated genes
Genome	Genes	Operons
Cellvibrio japonicus Ueda107
Marinobacter aqueolei
Marinobacter sp. ELB17
Saccharophagus degradans 2-40
Teredinibacter turnerae T7901
Alcanivorax borkumensis SK2
Chromohalobacter salexigens DSM 3043
Hahella chejuensis KCTC 2396	7	2
Marinomonas sp. MWYL1	7	2
Oceanobacter sp. RED65
Oceanospirillum sp. MED92
Reinekea sp. MED297

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes													Function

CRON 1.
xltC	Cellvibrio japonicus Ueda107	Marinobacter aqueolei	Marinobacter sp. ELB17	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Alcanivorax borkumensis SK2	Chromohalobacter salexigens DSM 3043	* Hahella chejuensis KCTC 2396 Site: position = -203 score = 6.31668 sequence = TAATGTTAACGTTAACATTC Site: position = -138 score = 5.36119 sequence = AGATGTCAACGTTAGCGTTC Site: position = -67 score = 6.80921 sequence = AAATGTTAACGTTAACATTT Gene: HCH_02467: Xylitol ABC transporter, periplasmic substrate-binding protein	* Marinomonas sp. MWYL1 Site: position = -124 score = 5.67426 sequence = TGATGTTATCGTTAACATTT Site: position = -74 score = 4.80611 sequence = GAATGTGAATGTTAACGTTA Site: position = -68 score = 6.31668 sequence = GAATGTTAACGTTAACATTA Gene: Mmwyl1_1985: Xylitol ABC transporter, periplasmic substrate-binding protein	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Reinekea sp. MED297	Xylitol ABC transporter, periplasmic substrate-binding protein
xltA	Cellvibrio japonicus Ueda107	Marinobacter aqueolei	Marinobacter sp. ELB17	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Alcanivorax borkumensis SK2	Chromohalobacter salexigens DSM 3043	Hahella chejuensis KCTC 2396 Gene: HCH_02469: Xylitol ABC transporter, ATP-binding component	Marinomonas sp. MWYL1 Gene: Mmwyl1_1986: Xylitol ABC transporter, ATP-binding component	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Reinekea sp. MED297	Xylitol ABC transporter, ATP-binding component
xltB	Cellvibrio japonicus Ueda107	Marinobacter aqueolei	Marinobacter sp. ELB17	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Alcanivorax borkumensis SK2	Chromohalobacter salexigens DSM 3043	Hahella chejuensis KCTC 2396 Gene: HCH_02470: Xylitol ABC transporter, permease component	Marinomonas sp. MWYL1 Gene: Mmwyl1_1987: Xylitol ABC transporter, permease component	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Reinekea sp. MED297	Xylitol ABC transporter, permease component
xltF	Cellvibrio japonicus Ueda107	Marinobacter aqueolei	Marinobacter sp. ELB17	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Alcanivorax borkumensis SK2	Chromohalobacter salexigens DSM 3043	Hahella chejuensis KCTC 2396 Gene: HCH_02471: Xylitol dehydrogenase (EC 1.1.1.9)	Marinomonas sp. MWYL1	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Reinekea sp. MED297	Xylitol dehydrogenase (EC 1.1.1.9)
xylB	Cellvibrio japonicus Ueda107	Marinobacter aqueolei	Marinobacter sp. ELB17	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Alcanivorax borkumensis SK2	Chromohalobacter salexigens DSM 3043 Gene: Csal_0644: Xylulose kinase (EC 2.7.1.17)	2 Hahella chejuensis KCTC 2396 Gene: HCH_02472: Xylulose kinase (EC 2.7.1.17) Gene: HCH_03095: Xylulose kinase (EC 2.7.1.17)	2 Marinomonas sp. MWYL1 Gene: Mmwyl1_1989: Xylulose kinase (EC 2.7.1.17) Gene: Mmwyl1_1988: Xylulose kinase (EC 2.7.1.17)	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Reinekea sp. MED297	Xylulose kinase (EC 2.7.1.17)
tal	Cellvibrio japonicus Ueda107	Marinobacter aqueolei	Marinobacter sp. ELB17	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Alcanivorax borkumensis SK2	Chromohalobacter salexigens DSM 3043	Hahella chejuensis KCTC 2396 Gene: HCH_02473: Transaldolase (EC 2.2.1.2)	Marinomonas sp. MWYL1	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Reinekea sp. MED297 Gene: MED297_16799: Transaldolase (EC 2.2.1.2)	Transaldolase (EC 2.2.1.2)
dhs	Cellvibrio japonicus Ueda107	Marinobacter aqueolei	Marinobacter sp. ELB17	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Alcanivorax borkumensis SK2	Chromohalobacter salexigens DSM 3043	Hahella chejuensis KCTC 2396	Marinomonas sp. MWYL1 Gene: Mmwyl1_1990: Diacetyl/L-xylulose reductase (EC 1.1.1.10)	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Reinekea sp. MED297	Diacetyl/L-xylulose reductase (EC 1.1.1.10)

CRON 2.
xltR	Cellvibrio japonicus Ueda107	Marinobacter aqueolei	Marinobacter sp. ELB17	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Alcanivorax borkumensis SK2	Chromohalobacter salexigens DSM 3043	* Hahella chejuensis KCTC 2396 Site: position = -180 score = 5.36119 sequence = GAACGCTAACGTTGACATCT Site: position = -115 score = 6.31668 sequence = GAATGTTAACGTTAACATTA Gene: HCH_02466: Transcriptional regulator of xylitol utilization, LacI family	* Marinomonas sp. MWYL1 Site: position = -187 score = 6.31668 sequence = TAATGTTAACGTTAACATTC Site: position = -181 score = 4.80611 sequence = TAACGTTAACATTCACATTC Site: position = -131 score = 5.67426 sequence = AAATGTTAACGATAACATCA Gene: Mmwyl1_1984: Transcriptional regulator of xylitol utilization, LacI family	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Reinekea sp. MED297	Transcriptional regulator of xylitol utilization, LacI family

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog XltR - Oceanospirillales/Alteromonadales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --