Regulon of ManR1 in Pseudoalteromonas tunicata D2

Properties
Regulator type:	Transcription factor
TF locus tag:	PTD2_03216
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Mannosides utilization; Mannose utilization
Effector:	Mannose
Regulog:	ManR1 - Alteromonadales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Alteromonadales
By TF family - LacI
By effector - Mannose
By pathway - Mannosides utilization
By pathway - Mannose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -69 Score: 6 Sequence: TTATTGGAGCGTTCCAAAAG Locus tag: PTD2_02171 Name: manI Funciton: D-mannose isomerase (EC 5.3.1.7)
	PTD2_02171	manI	D-mannose isomerase (EC 5.3.1.7)
Position: -31 Score: 6 Sequence: TGCTTGGAACGATCCAATTA Locus tag: PTD2_02161 Name: mnnA1 Funciton: Alpha-1,2-mannosidase
	PTD2_02161	mnnA1	Alpha-1,2-mannosidase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD