Regulon of ManR1 in Colwellia psychrerythraea 34H

Properties
Regulator type:	Transcription factor
TF locus tag:	CPS_2652
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Mannosides utilization; Mannose utilization
Effector:	Mannose
Regulog:	ManR1 - Alteromonadales
Statistics of regulated genes:
- Genes	7
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Alteromonadales
By TF family - LacI
By effector - Mannose
By pathway - Mannosides utilization
By pathway - Mannose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -152 Score: 6.4 Sequence: GCATTGGAACGTTCCAATTA Position: -64 Score: 5.5 Sequence: ATAACGGAACGTTCCACTTA Locus tag: CPS_2653 Name: omp(Man) Funciton: Mannosides-regulated TonB-dependent outer membrane receptor
	CPS_2653	omp(Man)	Mannosides-regulated TonB-dependent outer membrane receptor
Position: -102 Score: 6.8 Sequence: TTTTTGGAACGTTCCAATTA Locus tag: CPS_2652 Name: manR1 Funciton: Transcriptional regulator of mannoside utilization, LacI family
	CPS_2652	manR1	Transcriptional regulator of mannoside utilization, LacI family
Position: -40 Score: 6.8 Sequence: TAATTGGAACGTTCCAAAAA Locus tag: CPS_2651 Name: mnnA1 Funciton: Alpha-1,2-mannosidase Locus tag: CPS_2650 Name: mnnA1 Funciton: Alpha-1,2-mannosidase Locus tag: CPS_2649 Name: manP1 Funciton: Predicted mannose transporter, GGP family Locus tag: CPS_2648 Name: manK Funciton: Fructokinase in mannoside utilization gene cluster (EC 2.7.1.4) Locus tag: CPS_2647 Name: manI Funciton: D-mannose isomerase (EC 5.3.1.7)
	CPS_2651	mnnA1	Alpha-1,2-mannosidase
	CPS_2650	mnnA1	Alpha-1,2-mannosidase
	CPS_2649	manP1	Predicted mannose transporter, GGP family
	CPS_2648	manK	Fructokinase in mannoside utilization gene cluster (EC 2.7.1.4)
	CPS_2647	manI	D-mannose isomerase (EC 5.3.1.7)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD