Regulon of ManR1 in Alteromonadales bacterium TW-7
| Regulator type: | Transcription factor |
| TF locus tag: | ATW7_02272 |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Mannosides utilization; Mannose utilization |
| Effector: | Mannose |
| Regulog: | ManR1 - Alteromonadales |
| Statistics of regulated genes: | |
| - Genes | 1 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Alteromonadales
- By TF family - LacI
- By effector - Mannose
- By pathway - Mannosides utilization
- By pathway - Mannose utilization
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -87
Score: 6.2 Sequence: AATTTGGAACGTTCTAATTA
Locus tag: ATW7_00410
Name: manP1 Funciton: Predicted mannose transporter, GGP family |
|||
|
manP1
|
Predicted mannose transporter, GGP family
|
||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |