Regulon of ManR1 in Alteromonadales bacterium TW-7

Properties
Regulator type:	Transcription factor
TF locus tag:	ATW7_02272
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Mannosides utilization; Mannose utilization
Effector:	Mannose
Regulog:	ManR1 - Alteromonadales
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Alteromonadales
By TF family - LacI
By effector - Mannose
By pathway - Mannosides utilization
By pathway - Mannose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -87 Score: 6.2 Sequence: AATTTGGAACGTTCTAATTA Locus tag: ATW7_00410 Name: manP1 Funciton: Predicted mannose transporter, GGP family
	ATW7_00410	manP1	Predicted mannose transporter, GGP family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD