Regulon of EF1410 in Enterococcus faecalis V583

Properties
Regulator type:	Transcription factor
TF locus tag:	EF1410
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	EF1410 - Enterococcaceae
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Enterococcaceae
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -119 Score: 6.5 Sequence: AATTGTTATCGTTTACATCT Locus tag: EF1410 Name: EF1410 Funciton: Predicted transcriptional regulator, LacI family
	EF1410	EF1410	Predicted transcriptional regulator, LacI family
Position: -42 Score: 6.5 Sequence: AGATGTAAACGATAACAATT Locus tag: EF1411 Name: EF1411 Funciton: Predicted glycosyl hydrolase, family 4
	EF1411	EF1411	Predicted glycosyl hydrolase, family 4

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD