Regulog EF1410 - Enterococcaceae

Properties
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Phylum:	Firmicutes
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

Statistics of regulated genes
Genome	Genes	Operons
Enterococcus faecalis V583	2	2
Enterococcus faecium DO

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes			Function

CRON 1.
EF1411	* Enterococcus faecalis V583 Site: position = -42 score = 6.52087 sequence = AGATGTAAACGATAACAATT Gene: EF1411: Predicted glycosyl hydrolase, family 4	Enterococcus faecium DO	Predicted glycosyl hydrolase, family 4

CRON 2.
EF1410	* Enterococcus faecalis V583 Site: position = -119 score = 6.52087 sequence = AATTGTTATCGTTTACATCT Gene: EF1410: Predicted transcriptional regulator, LacI family	Enterococcus faecium DO	Predicted transcriptional regulator, LacI family

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --