Regulon of SPOA0336 in Sulfitobacter sp. EE-36

Properties
Regulator type:	Transcription factor
TF locus tag:	EE36_06243
Regulator family:	LacI
Regulation mode:
Biological process:	Sugar utilization
Effector:
Regulog:	SPOA0336 - Rhodobacterales
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Rhodobacterales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -74 Score: 5.5 Sequence: AGATGACAGCGCTGTCATTA Locus tag: EE36_06248 Name: SPOA0335 Funciton: TRAP dicarboxylate family transporter, DctP subunit Locus tag: EE36_06253 Name: SPOA0334 Funciton: TRAP dicarboxylate family transporter, DctQ subunit Locus tag: EE36_06258 Name: SPOA0333 Funciton: TRAP dicarboxylate family transporter, DctM subunit Locus tag: EE36_06263 Name: COG0129 Funciton: L-arabinonate dehydratase Locus tag: EE36_06268 Name: kdgK Funciton: 2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45)
	EE36_06248	SPOA0335	TRAP dicarboxylate family transporter, DctP subunit
	EE36_06253	SPOA0334	TRAP dicarboxylate family transporter, DctQ subunit
	EE36_06258	SPOA0333	TRAP dicarboxylate family transporter, DctM subunit
	EE36_06263	COG0129	L-arabinonate dehydratase
	EE36_06268	kdgK	2-dehydro-3-deoxygluconate kinase (EC 2.7.1.45)
Position: -64 Score: 5.5 Sequence: TAATGACAGCGCTGTCATCT Locus tag: EE36_06243 Name: SPOA0336 Funciton: Transcriptional regulator, LacI family
	EE36_06243	SPOA0336	Transcriptional regulator, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD