Regulon of Mll1683 in Rhizobium sp. NGR234

Properties
Regulator type:	Transcription factor
TF locus tag:
Regulator family:	LacI
Regulation mode:
Biological process:	Sugar utilization
Effector:
Regulog:	Mll1683 - Rhizobiales
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -262 Score: 6 Sequence: TATTGGTAGCGCTACCATTT Locus tag: NGR_b21720 Name: mll1682 Funciton: sugar ABC transporter, substrate-binding protein Locus tag: NGR_b21710 Name: mll1680 Funciton: sugar ABC transporter, ATP-binding protein Locus tag: NGR_b21700 Name: mll1679 Funciton: sugar ABC transporter, permease protein Locus tag: NGR_b21690 Name: mll1678 Funciton: sugar ABC transporter, permease protein
	NGR_b21720	mll1682	sugar ABC transporter, substrate-binding protein
	NGR_b21710	mll1680	sugar ABC transporter, ATP-binding protein
	NGR_b21700	mll1679	sugar ABC transporter, permease protein
	NGR_b21690	mll1678	sugar ABC transporter, permease protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD