Regulon of Mll1683 in Rhizobium leguminosarum bv. viciae 3841

Properties
Regulator type:	Transcription factor
TF locus tag:	RL1995
Regulator family:	LacI
Regulation mode:
Biological process:	Sugar utilization
Effector:
Regulog:	Mll1683 - Rhizobiales
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -154 Score: 4.7 Sequence: AGTTGACAGCGCTAGCAGAT Position: -131 Score: 5.2 Sequence: ATTTGACAGCGCTGTCAACT Locus tag: RL1996 Name: mll1682 Funciton: sugar ABC transporter, substrate-binding protein Locus tag: RL1997 Name: mll1680 Funciton: sugar ABC transporter, ATP-binding protein Locus tag: RL1998 Name: mll1679 Funciton: sugar ABC transporter, permease protein Locus tag: RL1999 Name: mll1678 Funciton: sugar ABC transporter, permease protein
	RL1996	mll1682	sugar ABC transporter, substrate-binding protein
	RL1997	mll1680	sugar ABC transporter, ATP-binding protein
	RL1998	mll1679	sugar ABC transporter, permease protein
	RL1999	mll1678	sugar ABC transporter, permease protein
Position: -117 Score: 5.2 Sequence: AGTTGACAGCGCTGTCAAAT Position: -94 Score: 4.7 Sequence: ATCTGCTAGCGCTGTCAACT Locus tag: RL1995 Name: mll1683 Funciton: Transcriptional regulator, LacI family
	RL1995	mll1683	Transcriptional regulator, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD