Regulon of Mll1683 in Rhizobium etli CFN 42

Properties
Regulator type:	Transcription factor
TF locus tag:	RHE_CH01786
Regulator family:	LacI
Regulation mode:
Biological process:	Sugar utilization
Effector:
Regulog:	Mll1683 - Rhizobiales
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -107 Score: 4.8 Sequence: AGTTGACAGCGCAGTCAAAC Position: -84 Score: 5.1 Sequence: ATTTGCTAGCGCTATCAACT Locus tag: RHE_CH01786 Name: mll1683 Funciton: Transcriptional regulator, LacI family
	RHE_CH01786	mll1683	Transcriptional regulator, LacI family
Position: -154 Score: 5.1 Sequence: AGTTGATAGCGCTAGCAAAT Position: -131 Score: 4.8 Sequence: GTTTGACTGCGCTGTCAACT Locus tag: RHE_CH01787 Name: mll1682 Funciton: sugar ABC transporter, substrate-binding protein Locus tag: RHE_CH01788 Name: mll1680 Funciton: sugar ABC transporter, ATP-binding protein Locus tag: RHE_CH01789 Name: mll1679 Funciton: sugar ABC transporter, permease protein Locus tag: RHE_CH01790 Name: mll1678 Funciton: sugar ABC transporter, permease protein
	RHE_CH01787	mll1682	sugar ABC transporter, substrate-binding protein
	RHE_CH01788	mll1680	sugar ABC transporter, ATP-binding protein
	RHE_CH01789	mll1679	sugar ABC transporter, permease protein
	RHE_CH01790	mll1678	sugar ABC transporter, permease protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD