Regulon of Mll1683 in Mesorhizobium loti MAFF303099

Properties
Regulator type:	Transcription factor
TF locus tag:	mll1683
Regulator family:	LacI
Regulation mode:
Biological process:	Sugar utilization
Effector:
Regulog:	Mll1683 - Rhizobiales
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -313 Score: 5.9 Sequence: CTATGGTAGCGCTACCATTT Locus tag: mll1682 Name: mll1682 Funciton: sugar ABC transporter, substrate-binding protein Locus tag: mll1680 Name: mll1680 Funciton: sugar ABC transporter, ATP-binding protein Locus tag: mll1679 Name: mll1679 Funciton: sugar ABC transporter, permease protein Locus tag: mll1678 Name: mll1678 Funciton: sugar ABC transporter, permease protein
	mll1682	mll1682	sugar ABC transporter, substrate-binding protein
	mll1680	mll1680	sugar ABC transporter, ATP-binding protein
	mll1679	mll1679	sugar ABC transporter, permease protein
	mll1678	mll1678	sugar ABC transporter, permease protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD