Regulon of Mll1683 in Bradyrhizobium japonicum USDA 110

Properties
Regulator type:	Transcription factor
TF locus tag:	bll3916
Regulator family:	LacI
Regulation mode:
Biological process:	Sugar utilization
Effector:
Regulog:	Mll1683 - Rhizobiales
Statistics of regulated genes:
- Genes	9
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -37 Score: 4.8 Sequence: TGCTGGTAGCGCTGTCAACG Locus tag: bll3916 Name: mll1683 Funciton: Transcriptional regulator, LacI family
	bll3916	mll1683	Transcriptional regulator, LacI family
Position: -153 Score: 5.6 Sequence: AAATGGTAGCGTTACCAAGT Locus tag: bll3915 Name: COG0129 Funciton: L-arabonate dehydratase Locus tag: bll3914 Name: COG4221 Funciton: 2-keto-3-deoxy-L-fuconate dehydrogenase Locus tag: bll3913 Name: COG1028 Funciton: 2-keto-3-deoxy-L-fuconate dehydrogenase
	bll3915	COG0129	L-arabonate dehydratase
	bll3914	COG4221	2-keto-3-deoxy-L-fuconate dehydrogenase
	bll3913	COG1028	2-keto-3-deoxy-L-fuconate dehydrogenase
Position: -162 Score: 4.8 Sequence: CGTTGACAGCGCTACCAGCA Locus tag: blr3917 Name: blr3917 Funciton: probable sugar ABC transporter, ATP-binding protein Locus tag: blr3918 Name: blr3918 Funciton: ABC transporter substrate-binding protein Locus tag: blr3919 Name: blr3919 Funciton: probable sugar ABC transporter, permease protein Locus tag: blr3920 Name: blr3920 Funciton: putative sugar uptake ABC transporter permease protein Locus tag: blr3921 Name: blr3921 Funciton: NAD-dependent epimerase/dehydratase
	blr3917	blr3917	probable sugar ABC transporter, ATP-binding protein
	blr3918	blr3918	ABC transporter substrate-binding protein
	blr3919	blr3919	probable sugar ABC transporter, permease protein
	blr3920	blr3920	putative sugar uptake ABC transporter permease protein
	blr3921	blr3921	NAD-dependent epimerase/dehydratase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD