Regulon of GntR in Shewanella baltica OS155

Properties
Regulator type:	Transcription factor
TF locus tag:	Sbal_4089
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Gluconate utilization
Effector:	Gluconate
Regulog:	GntR - Shewanellaceae
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - GntR
By TF family - LacI
By effector - Gluconate
By pathway - Gluconate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -74 Score: 5.6 Sequence: TCATATTACGGGTAACATGT Position: -60 Score: 5.7 Sequence: ACATGTTACCGGTAACCTAC Locus tag: Sbal_4088 Name: gntU Funciton: Low-affinity gluconate/H+ symporter GntU
	Sbal_4088	gntU	Low-affinity gluconate/H+ symporter GntU
Position: -30 Score: 5.7 Sequence: GTAGGTTACCGGTAACATGT Position: -16 Score: 5.6 Sequence: ACATGTTACCCGTAATATGA Locus tag: Sbal_4087 Name: gntK Funciton: Gluconokinase (EC 2.7.1.12)
	Sbal_4087	gntK	Gluconokinase (EC 2.7.1.12)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD