Regulon of HisR in Roseburia intestinalis L1-82

Properties
Regulator type:	Transcription factor
TF locus tag:	ROSINTL182_04526
Regulator family:	TrpR
Regulation mode:	repressor
Biological process:	Histidine biosynthesis
Effector:	Histidine
Regulog:	HisR - Clostridia-3
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 37 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-3
By trascription factor - HisR
By TF family - TrpR
By effector - Histidine
By pathway - Histidine biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -89 Score: 5.1 Sequence: CAAGGTAGCACACTAAAGTG Locus tag: ROSINTL182_03943 Name: hisZ Funciton: ATP phosphoribosyltransferase regulatory subunit (EC 2.4.2.17) Locus tag: ROSINTL182_03944 Name: hisG Funciton: ATP phosphoribosyltransferase catalytic subunit (EC 2.4.2.17)
	ROSINTL182_03943	hisZ	ATP phosphoribosyltransferase regulatory subunit (EC 2.4.2.17)
	ROSINTL182_03944	hisG	ATP phosphoribosyltransferase catalytic subunit (EC 2.4.2.17)
Position: -75 Score: 5.6 Sequence: AACTTTAATATGCTAAAATG Locus tag: ROSINTL182_04526 Name: hisR Funciton: Predicted histidine repressor, TrpR family
	ROSINTL182_04526	hisR	Predicted histidine repressor, TrpR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD