Regulon of HisR in Blautia hansenii DSM 20583

Properties
Regulator type:	Transcription factor
TF locus tag:	BLAHAN_01640
Regulator family:	TrpR
Regulation mode:	repressor
Biological process:	Histidine biosynthesis
Effector:	Histidine
Regulog:	HisR - Clostridia-3
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 37 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-3
By trascription factor - HisR
By TF family - TrpR
By effector - Histidine
By pathway - Histidine biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -68 Score: 4.6 Sequence: AAATTTACTGTGCTACTATA Locus tag: BLAHAN_01640 Name: hisR Funciton: Predicted histidine repressor, TrpR family
	BLAHAN_01640	hisR	Predicted histidine repressor, TrpR family
Position: -61 Score: 4.4 Sequence: CAATTTAGCATAGTAGAGAA Locus tag: BLAHAN_01245 Name: hisX Funciton: Histidine ABC transporter, histidine-binding protein (TC 3.A.1) Locus tag: BLAHAN_01244 Name: hisY Funciton: Histidine ABC transporter, permease protein Locus tag: BLAHAN_01243 Name: hisZ Funciton: Histidine ABC transporter, ATP-binding protein
	BLAHAN_01245	hisX	Histidine ABC transporter, histidine-binding protein (TC 3.A.1)
	BLAHAN_01244	hisY	Histidine ABC transporter, permease protein
	BLAHAN_01243	hisZ	Histidine ABC transporter, ATP-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD