Regulon of HisR in Bacteroides pectinophilus ATCC 43243

Properties
Regulator type:	Transcription factor
TF locus tag:	BACPEC_00270
Regulator family:	TrpR
Regulation mode:	repressor
Biological process:	Histidine biosynthesis
Effector:	Histidine
Regulog:	HisR - Clostridia-3
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 37 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-3
By trascription factor - HisR
By TF family - TrpR
By effector - Histidine
By pathway - Histidine biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -41 Score: 5.5 Sequence: CACGTTACCACGCTAAAGTG Locus tag: BACPEC_00055 Name: hisZ Funciton: ATP phosphoribosyltransferase regulatory subunit (EC 2.4.2.17)
	BACPEC_00055	hisZ	ATP phosphoribosyltransferase regulatory subunit (EC 2.4.2.17)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD