Regulon of NGR_b22600 in Rhizobium sp. NGR234

Properties
Regulator type:	Transcription factor
TF locus tag:	NGR_b22600
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	NGR_b22600 - Rhizobiales
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -154 Score: 4.3 Sequence: ATATGTATACGCATACATCC Position: -88 Score: 5.9 Sequence: CTATGTATGCGCTTACATTC Locus tag: NGR_b22590 Name: dctQ Funciton: C4-dicarboxylate ABC transporter, small permease component Locus tag: NGR_b22580 Name: dctM Funciton: C4-dicarboxylate ABC transporter, large permease component Locus tag: NGR_b22570 Name: dctP Funciton: C4-dicarboxylate ABC transporter, periplasmic component Locus tag: NGR_b22560 Name: garL Funciton: putative aldolase
	NGR_b22590	dctQ	C4-dicarboxylate ABC transporter, small permease component
	NGR_b22580	dctM	C4-dicarboxylate ABC transporter, large permease component
	NGR_b22570	dctP	C4-dicarboxylate ABC transporter, periplasmic component
	NGR_b22560	garL	putative aldolase
Position: -114 Score: 5.9 Sequence: GAATGTAAGCGCATACATAG Position: -48 Score: 4.3 Sequence: GGATGTATGCGTATACATAT Locus tag: NGR_b22600 Name: NGR_b22600 Funciton: Transcriptional regulator, LacI family Locus tag: NGR_b22610 Name: COG3971 Funciton: 2-keto-4-pentenoate hydratase
	NGR_b22600	NGR_b22600	Transcriptional regulator, LacI family
	NGR_b22610	COG3971	2-keto-4-pentenoate hydratase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD