Regulog NGR_b22600 - Rhizobiales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Proteobacteria/Alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Rhizobiales
- By TF family - LacI
- By pathway - Sugar utilization
| Genome | Genes | Operons |
|---|---|---|
| Agrobacterium tumefaciens str. C58 (Cereon) | ||
| Azorhizobium caulinodans ORS 571 | ||
| Bartonella quintana str. Toulouse | ||
| Bradyrhizobium japonicum USDA 110 | ||
| Bradyrhizobium sp. BTAi1 | ||
| Brucella melitensis 16M | ||
| Mesorhizobium loti MAFF303099 | ||
| Mesorhizobium sp. BNC1 | ||
| Nitrobacter winogradskyi Nb-255 | ||
| Rhizobium etli CFN 42 | ||
| Rhizobium leguminosarum bv. viciae 3841 | ||
| Rhizobium sp. NGR234 | 6 | 2 |
| Rhodopseudomonas palustris CGA009 | ||
| Sinorhizobium meliloti 1021 | ||
| Xanthobacter autotrophicus Py2 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| NGR_b22600 |
|
|
|
|
|
|
|
|
|
|
|
*
Rhizobium sp. NGR234 Site: position = -114 score = 5.87547 sequence = GAATGTAAGCGCATACATAG Site: position = -48 score = 4.29264 sequence = GGATGTATGCGTATACATAT Gene: NGR_b22600: Transcriptional regulator, LacI family |
|
|
|
Transcriptional regulator, LacI family |
| COG3971 |
|
|
|
|
|
|
|
|
|
|
|
Gene: NGR_b22610: 2-keto-4-pentenoate hydratase |
|
|
|
2-keto-4-pentenoate hydratase |
| CRON 2. | ||||||||||||||||
| dctQ |
|
|
|
|
|
|
|
|
|
|
|
*
Rhizobium sp. NGR234 Site: position = -154 score = 4.29264 sequence = ATATGTATACGCATACATCC Site: position = -88 score = 5.87547 sequence = CTATGTATGCGCTTACATTC Gene: NGR_b22590: C4-dicarboxylate ABC transporter, small permease component |
|
|
|
C4-dicarboxylate ABC transporter, small permease component |
| dctM |
|
|
|
|
|
|
|
|
|
|
|
Gene: NGR_b22580: C4-dicarboxylate ABC transporter, large permease component |
|
|
|
C4-dicarboxylate ABC transporter, large permease component |
| dctP |
|
|
|
|
|
|
|
|
|
|
|
Gene: NGR_b22570: C4-dicarboxylate ABC transporter, periplasmic component |
|
|
|
C4-dicarboxylate ABC transporter, periplasmic component |
| garL |
|
|
|
|
|
|
|
|
|
|
|
Gene: NGR_b22560: putative aldolase |
|
|
|
putative aldolase |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |