Regulon of SPO0590 in Silicibacter pomeroyi DSS-3

Properties
Regulator type:	Transcription factor
TF locus tag:	SPO0590
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	SPO0590 - Rhodobacterales
Statistics of regulated genes:
- Genes	9
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 21 sites [see more]

Member of regulog collections

By taxonomy - Rhodobacterales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -292 Score: 5.6 Sequence: GCGTGTAAGCGCTTGCATCG Position: -270 Score: 6.9 Sequence: AAATGTAAGCGCTTACATTG Locus tag: SPO0591 Name: dctP Funciton: C4-dicarboxylate ABC transporter, periplasmic component Locus tag: SPO0592 Name: dctQ Funciton: C4-dicarboxylate ABC transporter, small permease component Locus tag: SPO0593 Name: dctM Funciton: C4-dicarboxylate ABC transporter, large permease component Locus tag: SPO0594 Name: hisD1 Funciton: putative histidinol dehydrogenase Locus tag: SPO0595 Name: gno Funciton: Gluconate 5-dehydrogenase (EC 1.1.1.69) Locus tag: SPO0596 Name: sdh Funciton: Sorbitol dehydrogenase (EC 1.1.1.14) Locus tag: SPO0597 Name: usp Funciton: Universal stress family protein Locus tag: SPO0598 Name: ldh Funciton: L-lactate dehydrogenase (EC 1.1.2.3)
	SPO0591	dctP	C4-dicarboxylate ABC transporter, periplasmic component
	SPO0592	dctQ	C4-dicarboxylate ABC transporter, small permease component
	SPO0593	dctM	C4-dicarboxylate ABC transporter, large permease component
	SPO0594	hisD1	putative histidinol dehydrogenase
	SPO0595	gno	Gluconate 5-dehydrogenase (EC 1.1.1.69)
	SPO0596	sdh	Sorbitol dehydrogenase (EC 1.1.1.14)
	SPO0597	usp	Universal stress family protein
	SPO0598	ldh	L-lactate dehydrogenase (EC 1.1.2.3)
Position: -115 Score: 6.9 Sequence: CAATGTAAGCGCTTACATTT Position: -93 Score: 5.6 Sequence: CGATGCAAGCGCTTACACGC Locus tag: SPO0590 Name: SPO0590 Funciton: Transcriptional regulator, LacI family
	SPO0590	SPO0590	Transcriptional regulator, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD