Regulon of SPO0590 in Roseovarius sp. 217

Properties
Regulator type:	Transcription factor
TF locus tag:	ROS217_11196
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	SPO0590 - Rhodobacterales
Statistics of regulated genes:
- Genes	9
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 21 sites [see more]

Member of regulog collections

By taxonomy - Rhodobacterales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -265 Score: 6.6 Sequence: ATATGTAAGCGCTTACATTT Locus tag: ROS217_11206 Name: dctP Funciton: C4-dicarboxylate ABC transporter, periplasmic component Locus tag: ROS217_11211 Name: dctQ Funciton: C4-dicarboxylate ABC transporter, small permease component Locus tag: ROS217_11216 Name: dctM Funciton: C4-dicarboxylate ABC transporter, large permease component Locus tag: ROS217_11221 Name: hisD1 Funciton: putative histidinol dehydrogenase Locus tag: ROS217_11226 Name: gno Funciton: Gluconate 5-dehydrogenase (EC 1.1.1.69) Locus tag: ROS217_11231 Name: sdh Funciton: Sorbitol dehydrogenase (EC 1.1.1.14) Locus tag: ROS217_11236 Name: usp Funciton: Universal stress family protein Locus tag: ROS217_11241 Name: ldh Funciton: L-lactate dehydrogenase (EC 1.1.2.3)
	ROS217_11206	dctP	C4-dicarboxylate ABC transporter, periplasmic component
	ROS217_11211	dctQ	C4-dicarboxylate ABC transporter, small permease component
	ROS217_11216	dctM	C4-dicarboxylate ABC transporter, large permease component
	ROS217_11221	hisD1	putative histidinol dehydrogenase
	ROS217_11226	gno	Gluconate 5-dehydrogenase (EC 1.1.1.69)
	ROS217_11231	sdh	Sorbitol dehydrogenase (EC 1.1.1.14)
	ROS217_11236	usp	Universal stress family protein
	ROS217_11241	ldh	L-lactate dehydrogenase (EC 1.1.2.3)
Position: -96 Score: 6.6 Sequence: AAATGTAAGCGCTTACATAT Locus tag: ROS217_11196 Name: SPO0590 Funciton: Transcriptional regulator, LacI family
	ROS217_11196	SPO0590	Transcriptional regulator, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD