Regulon of SPO0590 in Roseobacter sp. MED193

Properties
Regulator type:	Transcription factor
TF locus tag:	MED193_17089
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	SPO0590 - Rhodobacterales
Statistics of regulated genes:
- Genes	11
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 21 sites [see more]

Member of regulog collections

By taxonomy - Rhodobacterales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -298 Score: 6.1 Sequence: CAATGTAAGGGCTTGCATAA Position: -275 Score: 6.7 Sequence: CCATGTAAGCGCTTACATTG Locus tag: MED193_17079 Name: dctP Funciton: C4-dicarboxylate ABC transporter, periplasmic component Locus tag: MED193_17074 Name: dctQ Funciton: C4-dicarboxylate ABC transporter, small permease component Locus tag: MED193_17069 Name: dctM Funciton: C4-dicarboxylate ABC transporter, large permease component Locus tag: MED193_17064 Name: hisD1 Funciton: putative histidinol dehydrogenase Locus tag: MED193_17059 Name: gno Funciton: Gluconate 5-dehydrogenase (EC 1.1.1.69) Locus tag: MED193_17054 Name: sdh Funciton: Sorbitol dehydrogenase (EC 1.1.1.14) Locus tag: MED193_17049 Name: usp Funciton: Universal stress family protein Locus tag: MED193_17044 Name: comD Funciton: Sulfopyruvate decarboxylase - alpha subunit (EC 4.1.1.79) Locus tag: MED193_17039 Name: comE Funciton: Sulfopyruvate decarboxylase - beta subunit (EC 4.1.1.79) Locus tag: MED193_17034 Name: ldh Funciton: L-lactate dehydrogenase (EC 1.1.2.3)
	MED193_17079	dctP	C4-dicarboxylate ABC transporter, periplasmic component
	MED193_17074	dctQ	C4-dicarboxylate ABC transporter, small permease component
	MED193_17069	dctM	C4-dicarboxylate ABC transporter, large permease component
	MED193_17064	hisD1	putative histidinol dehydrogenase
	MED193_17059	gno	Gluconate 5-dehydrogenase (EC 1.1.1.69)
	MED193_17054	sdh	Sorbitol dehydrogenase (EC 1.1.1.14)
	MED193_17049	usp	Universal stress family protein
	MED193_17044	comD	Sulfopyruvate decarboxylase - alpha subunit (EC 4.1.1.79)
	MED193_17039	comE	Sulfopyruvate decarboxylase - beta subunit (EC 4.1.1.79)
	MED193_17034	ldh	L-lactate dehydrogenase (EC 1.1.2.3)
Position: -136 Score: 6.7 Sequence: CAATGTAAGCGCTTACATGG Position: -113 Score: 6.1 Sequence: TTATGCAAGCCCTTACATTG Locus tag: MED193_17089 Name: SPO0590 Funciton: Transcriptional regulator, LacI family
	MED193_17089	SPO0590	Transcriptional regulator, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD