Regulon of SPO0590 in Jannaschia sp. CCS1

Properties
Regulator type:	Transcription factor
TF locus tag:	Jann_1347, Jann_1397
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	SPO0590 - Rhodobacterales
Statistics of regulated genes:
- Genes	12
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 21 sites [see more]

Member of regulog collections

By taxonomy - Rhodobacterales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -130 Score: 5.1 Sequence: AATTGTAATGGCTTGCATCG Position: -107 Score: 5.7 Sequence: TAATGTAAGGGCTTACACAC Locus tag: Jann_1398 Name: hisD1 Funciton: putative histidinol dehydrogenase Locus tag: Jann_1399 Name: gno Funciton: Gluconate 5-dehydrogenase (EC 1.1.1.69) Locus tag: Jann_1400 Name: sdh Funciton: Sorbitol dehydrogenase (EC 1.1.1.14) Locus tag: Jann_1401 Name: comD Funciton: Sulfopyruvate decarboxylase - alpha subunit (EC 4.1.1.79) Locus tag: Jann_1402 Name: comE Funciton: Sulfopyruvate decarboxylase - beta subunit (EC 4.1.1.79) Locus tag: Jann_1403 Name: ldh Funciton: L-lactate dehydrogenase (EC 1.1.2.3)
	Jann_1398	hisD1	putative histidinol dehydrogenase
	Jann_1399	gno	Gluconate 5-dehydrogenase (EC 1.1.1.69)
	Jann_1400	sdh	Sorbitol dehydrogenase (EC 1.1.1.14)
	Jann_1401	comD	Sulfopyruvate decarboxylase - alpha subunit (EC 4.1.1.79)
	Jann_1402	comE	Sulfopyruvate decarboxylase - beta subunit (EC 4.1.1.79)
	Jann_1403	ldh	L-lactate dehydrogenase (EC 1.1.2.3)
Position: -118 Score: 5.7 Sequence: CAATGTAAGCTGTTACAATT Position: -95 Score: 6.7 Sequence: AAATGCAAGCGCTTACATTT Locus tag: Jann_1347 Name: SPO0590 Funciton: Transcriptional regulator, LacI family
	Jann_1347	SPO0590	Transcriptional regulator, LacI family
Position: -281 Score: 5.7 Sequence: AATTGTAACAGCTTACATTG Locus tag: Jann_1349 Name: dctP Funciton: C4-dicarboxylate ABC transporter, periplasmic component Locus tag: Jann_1350 Name: dctQ Funciton: C4-dicarboxylate ABC transporter, small permease component Locus tag: Jann_1351 Name: dctM Funciton: C4-dicarboxylate ABC transporter, large permease component Locus tag: Jann_1352 Name: usp Funciton: Universal stress family protein
	Jann_1349	dctP	C4-dicarboxylate ABC transporter, periplasmic component
	Jann_1350	dctQ	C4-dicarboxylate ABC transporter, small permease component
	Jann_1351	dctM	C4-dicarboxylate ABC transporter, large permease component
	Jann_1352	usp	Universal stress family protein
Position: -79 Score: 5.7 Sequence: GTGTGTAAGCCCTTACATTA Position: -56 Score: 5.1 Sequence: CGATGCAAGCCATTACAATT Locus tag: Jann_1397 Name: SPO0590 Funciton: Transcriptional regulator, LacI family
	Jann_1397	SPO0590	Transcriptional regulator, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD