Regulon of YhcF in Listeria welshimeri serovar 6b str. SLCC5334

Properties
Regulator type:	Transcription factor
TF locus tag:	lwe1742
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug efflux; Multidrug resistance
Effector:
Regulog:	YhcF - Listeriaceae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Listeriaceae
By TF family - GntR/Others
By pathway - Multidrug efflux
By pathway - Multidrug resistance

Regulated operons
	Locus Tag	Name	Function
Position: -50 Score: 6.8 Sequence: AGTGTACTATTTACTTAATACACT Locus tag: lwe1742 Name: yhcF Funciton: Transcriptional regulator, GntR family Locus tag: lwe1741 Name: yhcG Funciton: ABC-type multidrug transport system, ATPase component Locus tag: lwe1740 Name: yhcI Funciton: ABC-type multidrug transport system, permease component
	lwe1742	yhcF	Transcriptional regulator, GntR family
	lwe1741	yhcG	ABC-type multidrug transport system, ATPase component
	lwe1740	yhcI	ABC-type multidrug transport system, permease component

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD