Regulon of YhcF in Listeria seeligeri serovar 1/2b str. SLCC3954

Properties
Regulator type:	Transcription factor
TF locus tag:	lse_1696
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug efflux; Multidrug resistance
Effector:
Regulog:	YhcF - Listeriaceae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Listeriaceae
By TF family - GntR/Others
By pathway - Multidrug efflux
By pathway - Multidrug resistance

Regulated operons
	Locus Tag	Name	Function
Position: -47 Score: 6.8 Sequence: AGTGTACTATTTACTTAATACACT Locus tag: lse_1696 Name: yhcF Funciton: Transcriptional regulator, GntR family Locus tag: lse_1695 Name: yhcG Funciton: ABC-type multidrug transport system, ATPase component Locus tag: lse_1694 Name: yhcI Funciton: ABC-type multidrug transport system, permease component
	lse_1696	yhcF	Transcriptional regulator, GntR family
	lse_1695	yhcG	ABC-type multidrug transport system, ATPase component
	lse_1694	yhcI	ABC-type multidrug transport system, permease component

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD