Regulon of YhcF in Listeria seeligeri serovar 1/2b str. SLCC3954
| Regulator type: | Transcription factor |
| TF locus tag: | lse_1696 |
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | Multidrug efflux; Multidrug resistance |
| Effector: | |
| Regulog: | YhcF - Listeriaceae |
| Statistics of regulated genes: | |
| - Genes | 3 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Listeriaceae
- By TF family - GntR/Others
- By pathway - Multidrug efflux
- By pathway - Multidrug resistance
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -47
Score: 6.8 Sequence: AGTGTACTATTTACTTAATACACT
Locus tag: lse_1696
Name: yhcF Funciton: Transcriptional regulator, GntR family
Locus tag: lse_1695
Name: yhcG Funciton: ABC-type multidrug transport system, ATPase component
Locus tag: lse_1694
Name: yhcI Funciton: ABC-type multidrug transport system, permease component |
|||
|
yhcF
|
Transcriptional regulator, GntR family
|
||
|
yhcG
|
ABC-type multidrug transport system, ATPase component
|
||
|
yhcI
|
ABC-type multidrug transport system, permease component
|
||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |