Regulon of AfrR in Jannaschia sp. CCS1

Properties
Regulator type:	Transcription factor
TF locus tag:	Jann_3927
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	1,5-Anhydro-d-Fructose utilization
Effector:
Regulog:	AfrR - Rhodobacterales
Statistics of regulated genes:
- Genes	12
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

By taxonomy - Rhodobacterales
By TF family - LacI
By pathway - 1,5-Anhydro-d-Fructose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -58 Score: 5.5 Sequence: ATTGTGGAACGTTCCAATTA Position: -33 Score: 5.8 Sequence: AAATCGGAACGTTCCAATTT Locus tag: Jann_3940 Name: afr Funciton: 1,5-anhydro-D-fructose reductase EC=1.1.1.292 Locus tag: Jann_3939 Name: null Funciton: coenzyme A transferase Locus tag: Jann_3938 Name: null Funciton: enoyl-CoA hydratase Locus tag: Jann_3937 Name: null Funciton: Betaine-aldehyde dehydrogenase EC=1.2.1.-
	Jann_3940	afr	1,5-anhydro-D-fructose reductase EC=1.1.1.292
	Jann_3939		coenzyme A transferase
	Jann_3938		enoyl-CoA hydratase
	Jann_3937		Betaine-aldehyde dehydrogenase EC=1.2.1.-
Position: -35 Score: 5.4 Sequence: GAATTGGAACGTTCCAGAAG Locus tag: Jann_3931 Name: null Funciton: FAD dependent oxidoreductase Locus tag: Jann_3930 Name: null Funciton: short-chain dehydrogenase/reductase SDR Locus tag: Jann_3929 Name: sdh Funciton: L-sorbose 1-dehydrogenase EC=1.1.99.32 Locus tag: Jann_3928 Name: null Funciton: hypothetical protein Locus tag: Jann_3927 Name: afrR Funciton: Transcriptional regulator for 1,5-Anhydro-d-Fructose utilization, LacI family Locus tag: Jann_3926 Name: null Funciton: Hydroxypyruvate reductase Locus tag: Jann_3925 Name: null Funciton: Stress responsive alpha-beta Locus tag: Jann_3924 Name: null Funciton: hypothetical protein
	Jann_3931		FAD dependent oxidoreductase
	Jann_3930		short-chain dehydrogenase/reductase SDR
	Jann_3929	sdh	L-sorbose 1-dehydrogenase EC=1.1.99.32
	Jann_3928		hypothetical protein
	Jann_3927	afrR	Transcriptional regulator for 1,5-Anhydro-d-Fructose utilization, LacI family
	Jann_3926		Hydroxypyruvate reductase
	Jann_3925		Stress responsive alpha-beta
	Jann_3924		hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD