Profile of regulator AfrR in Rhodobacterales

Properties
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	1,5-Anhydro-d-Fructose utilization
Effector:
Regulog:	AfrR - Rhodobacterales

Member of regulog collections

By taxonomy - Rhodobacterales
By TF family - LacI
By pathway - 1,5-Anhydro-d-Fructose utilization

Transcription factor binding sites

	Locus Tag	Name	Position	Score	Sequence
Jannaschia sp. CCS1
	Jann_3931	null	-35	5.4	GAATTGGAACGTTCCAGAAG
	Jann_3940	afr	-58	5.5	ATTGTGGAACGTTCCAATTA
	Jann_3940	afr	-33	5.8	AAATCGGAACGTTCCAATTT

Export
	Regulatory Sites	[ FASTA format ]	DOWNLOAD