Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Profile of regulator AfrR in Rhodobacterales

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: 1,5-Anhydro-d-Fructose utilization
Effector:
Regulog: AfrR - Rhodobacterales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Jannaschia sp. CCS1
Jann_3931 null -35 5.4 GAATTGGAACGTTCCAGAAG
Jann_3940 afr -58 5.5 ATTGTGGAACGTTCCAATTA
Jann_3940 afr -33 5.8 AAATCGGAACGTTCCAATTT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD