Regulon of AfrR in Sinorhizobium meliloti 1021

Properties
Regulator type:	Transcription factor
TF locus tag:	SMc04401
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	1,5-Anhydro-d-Fructose utilization
Effector:
Regulog:	AfrR - Rhizobiales
Statistics of regulated genes:
- Genes	12
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 19 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI
By pathway - 1,5-Anhydro-d-Fructose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -261 Score: 6 Sequence: AATTTAGATCGTTCCAAATT Position: -57 Score: 6.3 Sequence: AAATTGGAACGTTCCAATTA Locus tag: SMc04401 Name: afrR Funciton: Transcriptional regulator for 1,5-Anhydro-d-Fructose utilization, LacI family Locus tag: SMc04400 Name: afr Funciton: 1,5-anhydro-D-fructose reductase EC=1.1.1.292 Locus tag: SMc04399 Name: ydiF Funciton: putative CoA-transferase Locus tag: SMc04398 Name: crt Funciton: putative enoyl-CoA hydratase Locus tag: SMc04397 Name: aldh Funciton: putative aldehyde dehydrogenase Locus tag: SMc04396 Name: null Funciton: Sugar ABC transporter, substrate-binding protein Locus tag: SMc04395 Name: null Funciton: Sugar ABC transporter, inner membrane protein Locus tag: SMc04394 Name: null Funciton: Sugar ABC transporter, inner membrane protein Locus tag: SMc04393 Name: null Funciton: Sugar ABC transporter, ATP-binding protein Locus tag: SMc04392 Name: null Funciton: Glucose-methanol-choline (GMC) oxidoreductase:NAD binding site Locus tag: SMc04391 Name: fabG Funciton: putative oxidoreductase
	SMc04401	afrR	Transcriptional regulator for 1,5-Anhydro-d-Fructose utilization, LacI family
	SMc04400	afr	1,5-anhydro-D-fructose reductase EC=1.1.1.292
	SMc04399	ydiF	putative CoA-transferase
	SMc04398	crt	putative enoyl-CoA hydratase
	SMc04397	aldh	putative aldehyde dehydrogenase
	SMc04396		Sugar ABC transporter, substrate-binding protein
	SMc04395		Sugar ABC transporter, inner membrane protein
	SMc04394		Sugar ABC transporter, inner membrane protein
	SMc04393		Sugar ABC transporter, ATP-binding protein
	SMc04392		Glucose-methanol-choline (GMC) oxidoreductase:NAD binding site
	SMc04391	fabG	putative oxidoreductase
Position: -260 Score: 6.3 Sequence: TAATTGGAACGTTCCAATTT Position: -56 Score: 6 Sequence: AATTTGGAACGATCTAAATT Locus tag: SMc04402 Name: PF06187 Funciton: Protein of unknown function DUF993
	SMc04402	PF06187	Protein of unknown function DUF993

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD