Regulon of AfrR in Rhizobium sp. NGR234

Properties
Regulator type:	Transcription factor
TF locus tag:	NGR_c33000
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	1,5-Anhydro-d-Fructose utilization
Effector:
Regulog:	AfrR - Rhizobiales
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 19 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI
By pathway - 1,5-Anhydro-d-Fructose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -254 Score: 6 Sequence: AATTTAGATCGTTCCAAATT Position: -57 Score: 6.3 Sequence: AAATTGGAACGTTCCAATTA Locus tag: NGR_c33000 Name: afrR Funciton: Transcriptional regulator for 1,5-Anhydro-d-Fructose utilization, LacI family Locus tag: NGR_c33010 Name: afr Funciton: 1,5-anhydro-D-fructose reductase EC=1.1.1.292 Locus tag: NGR_c33020 Name: ydiF Funciton: putative CoA-transferase Locus tag: NGR_c33030 Name: crt Funciton: putative enoyl-CoA hydratase Locus tag: NGR_c33040 Name: aldh Funciton: putative aldehyde dehydrogenase
	NGR_c33000	afrR	Transcriptional regulator for 1,5-Anhydro-d-Fructose utilization, LacI family
	NGR_c33010	afr	1,5-anhydro-D-fructose reductase EC=1.1.1.292
	NGR_c33020	ydiF	putative CoA-transferase
	NGR_c33030	crt	putative enoyl-CoA hydratase
	NGR_c33040	aldh	putative aldehyde dehydrogenase
Position: -246 Score: 6.3 Sequence: TAATTGGAACGTTCCAATTT Position: -49 Score: 6 Sequence: AATTTGGAACGATCTAAATT Locus tag: NGR_c32990 Name: PF06187 Funciton: Protein of unknown function DUF993
	NGR_c32990	PF06187	Protein of unknown function DUF993

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD