Regulon of AfrR in Rhizobium leguminosarum bv. viciae 3841

Properties
Regulator type:	Transcription factor
TF locus tag:	RL1820
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	1,5-Anhydro-d-Fructose utilization
Effector:
Regulog:	AfrR - Rhizobiales
Statistics of regulated genes:
- Genes	12
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 19 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI
By pathway - 1,5-Anhydro-d-Fructose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -161 Score: 5.8 Sequence: TTTTTAGATCGTTCCAAATT Position: -56 Score: 6.2 Sequence: CAATTGGAACGTTCCAAATA Locus tag: RL1820 Name: afrR Funciton: Transcriptional regulator for 1,5-Anhydro-d-Fructose utilization, LacI family Locus tag: RL1821 Name: ydiF Funciton: putative CoA-transferase Locus tag: RL1822 Name: crt Funciton: putative enoyl-CoA hydratase Locus tag: RL1823 Name: aldh Funciton: putative aldehyde dehydrogenase Locus tag: RL1824 Name: null Funciton: Sugar ABC transporter, substrate-binding protein Locus tag: RL1825 Name: null Funciton: Sugar ABC transporter, inner membrane protein Locus tag: RL1826 Name: null Funciton: Sugar ABC transporter, inner membrane protein Locus tag: RL1827 Name: null Funciton: Sugar ABC transporter, ATP-binding protein Locus tag: RL1828 Name: null Funciton: Glucose-methanol-choline (GMC) oxidoreductase:NAD binding site Locus tag: RL1829 Name: null Funciton: Oxidoreductase, GMC family Locus tag: RL1830 Name: null Funciton: putative oxidoreductase Locus tag: RL1831 Name: null Funciton: putative oxidoreductase protein
	RL1820	afrR	Transcriptional regulator for 1,5-Anhydro-d-Fructose utilization, LacI family
	RL1821	ydiF	putative CoA-transferase
	RL1822	crt	putative enoyl-CoA hydratase
	RL1823	aldh	putative aldehyde dehydrogenase
	RL1824		Sugar ABC transporter, substrate-binding protein
	RL1825		Sugar ABC transporter, inner membrane protein
	RL1826		Sugar ABC transporter, inner membrane protein
	RL1827		Sugar ABC transporter, ATP-binding protein
	RL1828		Glucose-methanol-choline (GMC) oxidoreductase:NAD binding site
	RL1829		Oxidoreductase, GMC family
	RL1830		putative oxidoreductase
	RL1831		putative oxidoreductase protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD