Regulon of AfrR in Rhizobium etli CFN 42

Properties
Regulator type:	Transcription factor
TF locus tag:	RHE_CH01719
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	1,5-Anhydro-d-Fructose utilization
Effector:
Regulog:	AfrR - Rhizobiales
Statistics of regulated genes:
- Genes	12
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 19 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI
By pathway - 1,5-Anhydro-d-Fructose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -153 Score: 5.2 Sequence: GATTTAAATCGTTCCAAAAG Position: -57 Score: 6 Sequence: TTTTTGGAACGTTCCAAATA Locus tag: RHE_CH01719 Name: afrR Funciton: Transcriptional regulator for 1,5-Anhydro-d-Fructose utilization, LacI family Locus tag: RHE_CH01720 Name: ydiF Funciton: putative CoA-transferase Locus tag: RHE_CH01721 Name: crt Funciton: putative enoyl-CoA hydratase Locus tag: RHE_CH01722 Name: aldh Funciton: putative aldehyde dehydrogenase Locus tag: RHE_CH01723 Name: null Funciton: Sugar ABC transporter, substrate-binding protein Locus tag: RHE_CH01724 Name: null Funciton: Sugar ABC transporter, inner membrane protein Locus tag: RHE_CH01725 Name: null Funciton: Sugar ABC transporter, inner membrane protein Locus tag: RHE_CH01726 Name: null Funciton: Sugar ABC transporter, ATP-binding protein Locus tag: RHE_CH01727 Name: null Funciton: Glucose-methanol-choline (GMC) oxidoreductase:NAD binding site Locus tag: RHE_CH01728 Name: null Funciton: Oxidoreductase, GMC family Locus tag: RHE_CH01729 Name: null Funciton: putative oxidoreductase Locus tag: RHE_CH01730 Name: null Funciton: putative oxidoreductase protein
	RHE_CH01719	afrR	Transcriptional regulator for 1,5-Anhydro-d-Fructose utilization, LacI family
	RHE_CH01720	ydiF	putative CoA-transferase
	RHE_CH01721	crt	putative enoyl-CoA hydratase
	RHE_CH01722	aldh	putative aldehyde dehydrogenase
	RHE_CH01723		Sugar ABC transporter, substrate-binding protein
	RHE_CH01724		Sugar ABC transporter, inner membrane protein
	RHE_CH01725		Sugar ABC transporter, inner membrane protein
	RHE_CH01726		Sugar ABC transporter, ATP-binding protein
	RHE_CH01727		Glucose-methanol-choline (GMC) oxidoreductase:NAD binding site
	RHE_CH01728		Oxidoreductase, GMC family
	RHE_CH01729		putative oxidoreductase
	RHE_CH01730		putative oxidoreductase protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD