Regulon of AfrR in Mesorhizobium loti MAFF303099

Properties
Regulator type:	Transcription factor
TF locus tag:	mlr3045
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	1,5-Anhydro-d-Fructose utilization
Effector:
Regulog:	AfrR - Rhizobiales
Statistics of regulated genes:
- Genes	14
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 19 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI
By pathway - 1,5-Anhydro-d-Fructose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -216 Score: 5.6 Sequence: TAAATGGAACGTTCCAATAA Position: -52 Score: 5.7 Sequence: GGATTAGAACGTTCCAATAG Locus tag: mlr3045 Name: afrR Funciton: Transcriptional regulator for 1,5-Anhydro-d-Fructose utilization, LacI family Locus tag: mlr3046 Name: afr Funciton: 1,5-anhydro-D-fructose reductase EC=1.1.1.292 Locus tag: mlr3047 Name: ydiF Funciton: putative CoA-transferase Locus tag: mlr3048 Name: crt Funciton: putative enoyl-CoA hydratase Locus tag: mlr3049 Name: aldh Funciton: putative aldehyde dehydrogenase Locus tag: mlr3050 Name: null Funciton: Sugar ABC transporter, substrate-binding protein Locus tag: mlr3052 Name: null Funciton: Sugar ABC transporter, inner membrane protein Locus tag: mlr3053 Name: null Funciton: Sugar ABC transporter, inner membrane protein Locus tag: mlr3054 Name: null Funciton: Sugar ABC transporter, ATP-binding protein Locus tag: mlr3056 Name: null Funciton: Glucose-methanol-choline (GMC) oxidoreductase:NAD binding site Locus tag: mlr3057 Name: fabG Funciton: putative oxidoreductase Locus tag: mlr3058 Name: null Funciton: Oxidoreductase, GMC family Locus tag: mlr3059 Name: null Funciton: hypothetical protein
	mlr3045	afrR	Transcriptional regulator for 1,5-Anhydro-d-Fructose utilization, LacI family
	mlr3046	afr	1,5-anhydro-D-fructose reductase EC=1.1.1.292
	mlr3047	ydiF	putative CoA-transferase
	mlr3048	crt	putative enoyl-CoA hydratase
	mlr3049	aldh	putative aldehyde dehydrogenase
	mlr3050		Sugar ABC transporter, substrate-binding protein
	mlr3052		Sugar ABC transporter, inner membrane protein
	mlr3053		Sugar ABC transporter, inner membrane protein
	mlr3054		Sugar ABC transporter, ATP-binding protein
	mlr3056		Glucose-methanol-choline (GMC) oxidoreductase:NAD binding site
	mlr3057	fabG	putative oxidoreductase
	mlr3058		Oxidoreductase, GMC family
	mlr3059		hypothetical protein
Position: -209 Score: 5.7 Sequence: CTATTGGAACGTTCTAATCC Position: -45 Score: 5.6 Sequence: TTATTGGAACGTTCCATTTA Locus tag: mll3044 Name: PF06187 Funciton: Protein of unknown function DUF993
	mll3044	PF06187	Protein of unknown function DUF993

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD