Regulon of IolR in Loktanella vestfoldensis SKA53

Properties
Regulator type:	Transcription factor
TF locus tag:	SKA53_08821
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Inositol utilization
Effector:
Regulog:	IolR - Rhodobacterales
Statistics of regulated genes:
- Genes	13
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 13 sites [see more]

Member of regulog collections

By taxonomy - Rhodobacterales
By TF family - LacI
By pathway - Inositol utilization

Regulated operons
	Locus Tag	Name	Function
Position: -46 Score: 6.9 Sequence: TTTTGCAACCGGTTGCAACC Locus tag: SKA53_08806 Name: null Funciton: oxidoreductase Locus tag: SKA53_08811 Name: iolE Funciton: myo-inositol catabolism protein Locus tag: SKA53_08816 Name: null Funciton: oxidoreductase
	SKA53_08806		oxidoreductase
	SKA53_08811	iolE	myo-inositol catabolism protein
	SKA53_08816		oxidoreductase
Position: -84 Score: 6.9 Sequence: GGTTGCAACCGGTTGCAAAA Locus tag: SKA53_08801 Name: iolD Funciton: 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase Locus tag: SKA53_08796 Name: iolC Funciton: 5-keto-2-deoxygluconokinase (EC 2.7.1.92) Locus tag: SKA53_08791 Name: iolB Funciton: 5-deoxy-glucuronate isomerase (EC 5.3.1.-) Locus tag: SKA53_08786 Name: iolJ Funciton: 5-keto-2-deoxy-D-gluconate-6 phosphate aldolase (EC 4.1.2.29) Locus tag: SKA53_08781 Name: iolG Funciton: Myo-inositol 2-dehydrogenase EC=1.1.1.18
	SKA53_08801	iolD	3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase
	SKA53_08796	iolC	5-keto-2-deoxygluconokinase (EC 2.7.1.92)
	SKA53_08791	iolB	5-deoxy-glucuronate isomerase (EC 5.3.1.-)
	SKA53_08786	iolJ	5-keto-2-deoxy-D-gluconate-6 phosphate aldolase (EC 4.1.2.29)
	SKA53_08781	iolG	Myo-inositol 2-dehydrogenase EC=1.1.1.18
Position: -95 Score: 6.7 Sequence: AATTGCAACCGGTTGCAAAA Locus tag: SKA53_08821 Name: iolR Funciton: Transcriptional regulator of inositol utilization, LacI famil
	SKA53_08821	iolR	Transcriptional regulator of inositol utilization, LacI famil
Position: -111 Score: 6.7 Sequence: TTTTGCAACCGGTTGCAATT Locus tag: SKA53_08826 Name: iolK Funciton: Sugar ABC transporter, substrate-binding protein Locus tag: SKA53_08831 Name: iolL Funciton: Sugar ABC transporter, inner membrane protein Locus tag: SKA53_08836 Name: iolM Funciton: Sugar ABC transporter, ATP-binding protein Locus tag: SKA53_08841 Name: iolB Funciton: 5-deoxy-glucuronate isomerase (EC 5.3.1.-)
	SKA53_08826	iolK	Sugar ABC transporter, substrate-binding protein
	SKA53_08831	iolL	Sugar ABC transporter, inner membrane protein
	SKA53_08836	iolM	Sugar ABC transporter, ATP-binding protein
	SKA53_08841	iolB	5-deoxy-glucuronate isomerase (EC 5.3.1.-)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD