Regulon of IolR in Jannaschia sp. CCS1

Properties
Regulator type:	Transcription factor
TF locus tag:	Jann_1424
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Inositol utilization
Effector:
Regulog:	IolR - Rhodobacterales
Statistics of regulated genes:
- Genes	14
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 13 sites [see more]

Member of regulog collections

By taxonomy - Rhodobacterales
By TF family - LacI
By pathway - Inositol utilization

Regulated operons
	Locus Tag	Name	Function
Position: -44 Score: 6.9 Sequence: TTTTGCAAGCGGTTGCAACA Locus tag: Jann_1421 Name: null Funciton: oxidoreductase Locus tag: Jann_1422 Name: iolE Funciton: myo-inositol catabolism protein Locus tag: Jann_1423 Name: null Funciton: oxidoreductase
	Jann_1421		oxidoreductase
	Jann_1422	iolE	myo-inositol catabolism protein
	Jann_1423		oxidoreductase
Position: -126 Score: 7.4 Sequence: TTTTGCAACCGGTTGCAAAA Locus tag: Jann_1425 Name: iolK Funciton: Sugar ABC transporter, substrate-binding protein Locus tag: Jann_1426 Name: iolL Funciton: Sugar ABC transporter, inner membrane protein Locus tag: Jann_1427 Name: iolM Funciton: Sugar ABC transporter, ATP-binding protein Locus tag: Jann_1428 Name: null Funciton: Phytanoyl-CoA dioxygenase Locus tag: Jann_1429 Name: iolB Funciton: 5-deoxy-glucuronate isomerase (EC 5.3.1.-)
	Jann_1425	iolK	Sugar ABC transporter, substrate-binding protein
	Jann_1426	iolL	Sugar ABC transporter, inner membrane protein
	Jann_1427	iolM	Sugar ABC transporter, ATP-binding protein
	Jann_1428		Phytanoyl-CoA dioxygenase
	Jann_1429	iolB	5-deoxy-glucuronate isomerase (EC 5.3.1.-)
Position: -97 Score: 6.9 Sequence: TGTTGCAACCGCTTGCAAAA Locus tag: Jann_1420 Name: iolD Funciton: 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase Locus tag: Jann_1419 Name: iolC Funciton: 5-keto-2-deoxygluconokinase (EC 2.7.1.92) Locus tag: Jann_1418 Name: iolB Funciton: 5-deoxy-glucuronate isomerase (EC 5.3.1.-) Locus tag: Jann_1417 Name: iolJ Funciton: 5-keto-2-deoxy-D-gluconate-6 phosphate aldolase (EC 4.1.2.29) Locus tag: Jann_1416 Name: iolG Funciton: Myo-inositol 2-dehydrogenase EC=1.1.1.18
	Jann_1420	iolD	3D-(3,5/4)-trihydroxycyclohexane-1,2-dione hydrolase
	Jann_1419	iolC	5-keto-2-deoxygluconokinase (EC 2.7.1.92)
	Jann_1418	iolB	5-deoxy-glucuronate isomerase (EC 5.3.1.-)
	Jann_1417	iolJ	5-keto-2-deoxy-D-gluconate-6 phosphate aldolase (EC 4.1.2.29)
	Jann_1416	iolG	Myo-inositol 2-dehydrogenase EC=1.1.1.18
Position: -95 Score: 7.4 Sequence: TTTTGCAACCGGTTGCAAAA Locus tag: Jann_1424 Name: iolR Funciton: Transcriptional regulator of inositol utilization, LacI famil
	Jann_1424	iolR	Transcriptional regulator of inositol utilization, LacI famil

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD