Regulon of GabR in Corynebacterium glutamicum ATCC 13032

Properties
Regulator type:	Transcription factor
TF locus tag:	cg0565
Regulator family:	[Other]
Regulation mode:
Biological process:	Gamma-aminobutyrate utilization
Effector:
Regulog:	GabR - Corynebacteriaceae
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By taxonomy - Corynebacteriaceae
By TF family - [Other]
By pathway - Gamma-aminobutyrate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -113 Score: 4.9 Sequence: ATGGGCGAAATATTGTCTACAAC Locus tag: cg0566 Name: gabT2 Funciton: Gamma-aminobutyrate:alpha-ketoglutarate aminotransferase (EC 2.6.1.19) Locus tag: cg0567 Name: gabD2 Funciton: Succinate-semialdehyde dehydrogenase [NADP+] (EC 1.2.1.16) Locus tag: cg0568 Name: gabP Funciton: Predicted amino acids permease
	cg0566	gabT2	Gamma-aminobutyrate:alpha-ketoglutarate aminotransferase (EC 2.6.1.19)
	cg0567	gabD2	Succinate-semialdehyde dehydrogenase [NADP+] (EC 1.2.1.16)
	cg0568	gabP	Predicted amino acids permease
Position: -50 Score: 4.9 Sequence: GTTGTAGACAATATTTCGCCCAT Locus tag: cg0565 Name: gabR Funciton: Predicted transcriptional regulator of gamma-aminobutyrate utilization, COG2508 family
	cg0565	gabR	Predicted transcriptional regulator of gamma-aminobutyrate utilization, COG2508 family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD