Regulog GabR - Corynebacteriaceae
| Regulator type: | Transcription factor |
| Regulator family: | [Other] |
| Regulation mode: | |
| Biological process: | Gamma-aminobutyrate utilization |
| Effector: | |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Corynebacteriaceae
- By TF family - [Other]
- By pathway - Gamma-aminobutyrate utilization
| Genome | Genes | Operons |
|---|---|---|
| Corynebacterium amycolatum SK46 | ||
| Corynebacterium aurimucosum ATCC 700975 | 9 | 5 |
| Corynebacterium diphtheriae NCTC 13129 | ||
| Corynebacterium efficiens YS-314 | ||
| Corynebacterium glutamicum ATCC 13032 | 4 | 2 |
| Corynebacterium jeikeium K411 | ||
| Corynebacterium kroppenstedtii DSM 44385 | ||
| Corynebacterium urealyticum DSM 7109 |
| Genes | Function | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||
| gabT2 |
|
*2
Corynebacterium aurimucosum ATCC 700975 Site: position = -207 score = 5.20225 sequence = ATCGTGCAGAATTTCTATCCCCA Site: position = -113 score = 5.53957 sequence = ATTGTGGACAATTTCTCACCATT Gene: cauri_0643: Gamma-aminobutyrate:alpha-ketoglutarate aminotransferase (EC 2.6.1.19) Site: position = -96 score = 5.36301 sequence = TAGGTGCAAAATTTATACACCCT Gene: cauri_0646: Gamma-aminobutyrate:alpha-ketoglutarate aminotransferase (EC 2.6.1.19) |
|
|
*
Corynebacterium glutamicum ATCC 13032 Site: position = -113 score = 4.86861 sequence = ATGGGCGAAATATTGTCTACAAC Gene: cg0566: Gamma-aminobutyrate:alpha-ketoglutarate aminotransferase (EC 2.6.1.19) |
|
|
|
Gamma-aminobutyrate:alpha-ketoglutarate aminotransferase (EC 2.6.1.19) |
| gabD2 |
Gene: CORAM0001_0315: Succinate-semialdehyde dehydrogenase [NADP+] (EC 1.2.1.16) |
|
Gene: DIP0833: Succinate-semialdehyde dehydrogenase [NADP+] (EC 1.2.1.16) |
|
Gene: cg0567: Succinate-semialdehyde dehydrogenase [NADP+] (EC 1.2.1.16) |
Gene: jk0450: Succinate-semialdehyde dehydrogenase [NADP+] (EC 1.2.1.16) |
|
Gene: cur_1509: Succinate-semialdehyde dehydrogenase [NADP+] (EC 1.2.1.16) |
Succinate-semialdehyde dehydrogenase [NADP+] (EC 1.2.1.16) |
| gabP |
|
Gene: cauri_0647: Predicted amino acids permease |
|
|
Gene: cg0568: Predicted amino acids permease |
|
|
|
Predicted amino acids permease |
| hapE |
|
Gene: cauri_0642: 4-hydroxyacetophenone monooxygenase (EC 1.14.13.84) |
|
|
|
|
|
|
4-hydroxyacetophenone monooxygenase (EC 1.14.13.84) |
| lipN |
|
Gene: cauri_0641: Putative lipase/esterase |
|
|
|
|
|
|
Putative lipase/esterase |
| CRON 2. | |||||||||
| gabD1 |
|
*
Corynebacterium aurimucosum ATCC 700975 Site: position = -45 score = 4.04044 sequence = ATGGGGTGCAACCCATACACACT Gene: cauri_0649: Succinate-semialdehyde dehydrogenase [NADP+] (EC 1.2.1.16) |
|
|
|
|
|
|
Succinate-semialdehyde dehydrogenase [NADP+] (EC 1.2.1.16) |
| cauri_0648 |
|
Gene: cauri_0648: Hypothetical protein |
|
|
|
|
|
|
Hypothetical protein |
| CRON 3. | |||||||||
| gabR |
|
*2
Corynebacterium aurimucosum ATCC 700975 Site: position = -44 score = 5.20225 sequence = TGGGGATAGAAATTCTGCACGAT Site: position = -138 score = 5.53957 sequence = AATGGTGAGAAATTGTCCACAAT Gene: cauri_0644: Predicted transcriptional regulator of gamma-aminobutyrate utilization, COG2508 family Site: position = -44 score = 5.36301 sequence = AGGGTGTATAAATTTTGCACCTA Gene: cauri_0645: Predicted transcriptional regulator of gamma-aminobutyrate utilization, COG2508 family |
|
|
*
Corynebacterium glutamicum ATCC 13032 Site: position = -50 score = 4.86861 sequence = GTTGTAGACAATATTTCGCCCAT Gene: cg0565: Predicted transcriptional regulator of gamma-aminobutyrate utilization, COG2508 family |
|
|
|
Predicted transcriptional regulator of gamma-aminobutyrate utilization, COG2508 family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |