Regulon of CscR in Proteus mirabilis HI4320

Properties
Regulator type:	Transcription factor
TF locus tag:	PMI2191
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sucrose utilization
Effector:	Sucrose
Regulog:	CscR - Enterobacteriales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - LacI
By effector - Sucrose
By pathway - Sucrose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -133 Score: 4.9 Sequence: TCCTGATAACGTTAACATAA Position: -65 Score: 4.6 Sequence: AAATGTTATCGCTAATAAGG Locus tag: PMI2190 Name: cscA Funciton: Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
	PMI2190	cscA	Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
Position: -116 Score: 6.4 Sequence: ATATGTTAACGTTAACTTTA Position: -53 Score: 5.9 Sequence: TAGAGTTAACGTTAACATTC Locus tag: PMI0850 Name: cscB Funciton: Sucrose permease, major facilitator superfamily
	PMI0850	cscB	Sucrose permease, major facilitator superfamily

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD